Molecular Genetics
Which bases are considered "Purine"
Adenine and Guanine
How many nucleosomes make up a solenoid?
Six
What is protein structure assembled?
Ribosome
A point mutation is defined as
mutations that are specific to one base pair within the DNA molecule
What is a specific example of a nonsense mutation
(early stop codon)
Describe the function of DNA Helicase
Unwinds and separates hydrogen bonds of DNA
Repeats of non-coding DNA sequences at the end of a chromosome that protects coding regions from being lost
Telomere
Define what a Codon is?
coding triplet of mRNA bases
the relocation of groups of base pairs from one part of the genome to another
Translocation
Mutations may be ____ and _____
Spontaneous and induced
How many hydrogen bonds are between C and G bases?
Triple Bond
What is the "Hayflick" Limit?
the limit to the number of cell divisions
_________ are cut out of the initial transcript by spliceosomes
Introns
causes a frameshift in the code is known as a ___
Frameshift Mutation
An example of a missence mutation is
Sickle cell anemia
Every _______# nucleotides is one complete helical turn
10
Explain the relationship between Telomeres and cancer?
Telomerase build up leading to immortal cells
What are the three types of RNA?
Trna, Mrna, rRNA
What is a type of mutation that (occur on the non coding sections of the DNA )
Silent Mutation
a reversal in the orientation of a section of chromosome, leading to the backwards transcription and translation
What is the main difference between semiconservative and conservative replication?
Conservative = One complete new strand of Old and New DNA
Semiconservative - Two DNA strands with a mix of old and new DNA
What are the four functions of a Telomere?
Help prevent chromosome ends from joining
together
Prevent DNA degradation from nucleases
Assist in DNA repair in recognizing DNA breaks
from chromosomes
Play a role in the number of times a cell can
divide (lifespan)
is a theory stating that genetic information flows only in one direction, from DNA, to RNA, to protein, or RNA directly to protein
What are the four levels of control for gene expression?
1. Transcription level, Post-transcription level, Translation level and post-Translation level
ACGATACCCTGACGAGCGTTAGCTATCG
Write the complementary strand using Transcription
UGCUAUGGGACUGCU