This term is defined as the paired representation of heritable traits using a capital and a lowercase letter (Aa)
What is an allele?
This sugar is primarily found in DNA
What is Deoxyribose?
This term refers to a beneficial mutation that gets passed down to the next generation of offspring
What is an Adaptation?
This is the study of human interactions with the environment.
What is Environmental Science?
This is the name of Mr. Becker's home state, where he was born and raised.
What is Kansas?
This term represents the physical expression of a trait
What is phenotype?
This represents the three forms of RNA used in the process of Translation.
What are mRNA, rRNA, and tRNA?
This term refers to the ability to pass down a trait to the next generation
What is heritability?
This species interaction represents an interaction that benefits both species.
What is Mutualism?
This 1996 video game system is most notable for its three-armed controller and [name]-bit CPU. It is also the first game system that Mr. Becker played as a young child.
What is the Nintendo 64?
Genotypic Ratio: 0AA:4Aa:0aa
Phenotypic Ratio: 4D:0r
Transcribe the following strand into mRNA:
TATATACACCGGCGACAAA
What is AUAUAUGUGGCCGCUGUUU
This refers to the process in which adaptations build up over multiple generations until only the most beneficial adaptations survive
What is natural selection?
The first trophic level of a food web, including plants and other photosynthesizers.
What is a Primary Producer?
This 2004 Japanese animated film grossed $236 million at the box office, and includes such lovable characters as Turnip Head, Sophie, and Calcifer (voiced by the Billy Crystal in the English dub). It is also Mr. Becker's second-favorite movie behind Pixar's Wall-e
What is Howl's Moving Castle?
Find the phenotypic ratio of the following cross:
AaBb x AaBb
Translate the following strand into amino acids:
AUAU AUG CCG CAA UUG UAA UUUGGAGAG

MET, PRO, GLN, LEU
This term refers to an organism's ability to survive and reproduce in a given environment
What is fitness?
This refers to a species's specific role in an ecosystem, including what it eats, when it's active, where it lives, and how it interacts with other species.
What is a niche?
This is the name of Mr. Becker's cat.
Who is Storm?
Human blood type exhibits three alleles in its pairing set: IA (Dominant), IB (Dominant), and i (recessive). Given an IA/i genotype (Type A) and an IB/i genotype (Type B), identify the ratio of A:B:AB:O Blood Type
1A, 1B, 1AB, 1O
Translate the following strand into Amino Acids:
UAUAUCGGCGAGGCCAGAUGAAAUUGUGUGGCUAGAAA

MET, LYS, LEU, CYS, GLY
This term refers to the selection of favorable traits by humans to create better offspring
What is artificial selection?
This principle of Environmental Science describes what occurs when a common area is overexploited by multiple "owners"
What is the Tragedy of the Commons.
What is my favorite brand of jerky?
What is Old Trapper Old Fashioned?