DNA is made up of building blocks called?
Nucleotides
The act of cutting DNA by enzymes
Restriction Digest
The separation of nucleic acids or proteins on the basis of size (this is a lab technique)
gel electrophoresis
A sequence of nucleotides that codes for a protein
genes
Of the four bases: Which two always pair up?
Adenine - Thymine : Cytosine - Guanine
The place the enzyme cuts, varies by enzyme
Recognition site (restriction site)
During gel electrophoresis, DNA moves from the ______ end to the ______ end.
Negative ; Positive
Tiny structures inside cells that carry out specific functions for the cell
organelles
What makes up the backbone of a DNA molecule?
Sugar and Phosphate
Place the following steps of DNA analysis in the order in which they should be preformed
Restriction Digest, PCR, gel electrophoresis, DNA extraction
DNA extraction, PCR, Restriction Digest, Gel electrophoresis
See picture from teacher.
What is the approximate length of the band shown in red?
3150 bp
Proteins that DNA winds around to form chromosomes
histones
Which two bases are Pyrimidines?
Thymine & Cytosine
Does EcoRI leave blunt ends or sticky ends
sticky ends
See picture from teacher:
Whose DNA matches the blood found on the Table?
No one
Makes copies of DNA
PCR
The type of bond that joins nitrogen bases together
Hydrogen bonds
How many cuts will be made in the following sequence by using the HaeIII restriction enzyme?
CTGGCCTCGGCCTAGAACGGCCTAGCCG
GACCGGAGCCGGATCTTGCCGGATCGGC
3
See question on board
3
Come from bacteria: Cut DNA at specific places