PCR
What is PCR, and what is its purpose
Polymerase Chain reaction,
What is to amplify(make multiple copies of) target DNA in order to analyze and study.
What is Microevolution
Microevolution is a generation to generation change in a population’s allele frequencies (disruption to genetic equilibrium).
Who is the father of Genetics ?
What virus has spread across the globe, took hold in the United States,and has killed over 3.49 Million humans thus far.
What is the Corona Virus (Covid 19)
WHen Working with Hardy Weinberg equilibrum with 2 given alleles what are the two equations that are represented.
What are
p + q = 1
p2 + 2pq + q2 = 1
Which Cellular process does PCR represent?
What is DNA Replication?
What are the causes of Microevolution?
What are
1.Genetic Drift 2.Gene Flow 3.Mutation. 4.Selection
What are the three Laws of Inheritance
Law of Dominance
Law of Segregation
Law of Independent assortment
IN order, what are the essential parts of central dogma of Genetics, starting with in the genome.
1 --2--> 3 ---4--> 5
what is
DNA ( Transcriptions )RNA(Translation) Protein
What are the ingredients found in PCR?
What is
1.) Template DNA 2.) DNA polymerase
3.) Primers 4.) DNTPs
5.) Buffer
A city was intensively sprayed with KNJ in 1983 in an effort to control mosquitoes. The number of pests were immediately reduced to 1/3 its population size. Each year thereafter the city would spray KNJ, but the mosquitos gradually increased in numbers until 5 years later they were almost as abundant as they were when the control program began. Explain the phenomena
What is the type of Genetic Drift that occured was BottleNeck effect.
A good example of complex heredity is blood type. because there are more than 2 alleles that can be present. which type of dominance does this represent and give an example.
What is Codominance & AB blood type?
Six species of human coronaviruses are known, with one species subdivided into two different strains, making seven strains of human coronaviruses altogether. What causes of microevolution are pushing the spread of this virus.
What is the natural selection of the Mutated variants.
You have sampled a population in which you know that the percentage of the homozygous recessive genotype (aa) is 36%. Using that 36%, calculate the following:
A = a= AA = Aa =. aa=
what is
A = 40%. a = 60%. AA = 16% Aa = 48% aa = 36%
In the following DNA fragment, what is the target DNA sequence?
Forward Primer - GATTA -
Reverse Primer - AGGTC -
Template DNA: (5')TAGATTACTATGCGGACCTC (3')
(3')ATCTAATGATACGCCTGGAG (5')
What is
TARGET DNA: (5') CTATGCG (3')
(3') GATACGC (5')
In a population of 150 that is in Hardy-Weinberg equilibrium, 16% of the individuals are Dominant homozygotes for a certain trait. For the same trait, what is the number of individuals in this population that are heterozygotes? Show your Work
What is 48% (72 individuals)
Color pattern in a species of duck is determined by one gene with three alleles. Alleles G and H are codominant, and allele i is recessive to both. How many phenotypes are possible in a flock of ducks that contains all the possible combinations of these three alleles? List them
What are four G, H, GH, & ii
Given the following Viral RNA use the process of reverse transcription to determine the complementary and targeted DNA .
RNA (5') AUG - UCA - GGG - GUG - UGA (3')
cDNA
DNA
What is
cDNA (3') TAC - AGT - CCC - CAC - ACT (5')
DNA (5') ATG - TCA - GGG - GTG - TGA (3')
The ability to taste PTC is due to a single dominate allele "T". You sampled 215 individuals in biology, and determined that 150 could detect the bitter taste of PTC and 65 could not. Calculate all of the potential frequencies.
T= t = TT = Tt = tt =
What is
T = .55
t = .45
TT = .302
Tt = .495
tt = .2025