What can a legend on a crime scene sketch tell us?
Date, location
What components make up the integumentary system?
Hair, skin and nails
What lobe of the brain is at the front of the head and is responsible for higher reasoning and decision making?
Frontal lobe
What do you measure blood pressure with?
Sphygmomanometer (blood pressure cuff)
What is HIPAA?
Health insurance portability and accountability act. Protects a person's health information.
How can you calm a small child in the hospital?
Be nice, introduce yourself, let them know the plan of treatment or therapy...
What search pattern should be used in open water?
Spiral
What body system receives and interprets sensory information?
The Nervous system
What lobe of the brain is at the back of the head and regulates vision?
Occipital lobe
What do we check oxygen levels with?
Pulse oximeter
What is diabetes?
Hyperglycemia- sugar is too high
What is a positive feedback loop?
When the same stimulus occurs over and over until it is finally resolved. ex. labor
List the 4 physiological signs that polygraph tests monitor:
Heart rate, skin conductivity, blood pressure, and respiratory rate
What body system protects organs, produces blood, and stores minerals?
The skeleton system
What lobe of the brain sits near the ears and is responsible for hearing and long term memory?
Temporal
What do we use to listen to heart and lung sounds?
Stethoscope
How do we treat diabetes?
Insulin, diet, exercise
Can high cholesterol cause heart attacks if left untreated?
Yes
Name the 4 main fingerprint patterns:
Loop, whorl, arch, tented arch
Deceased body's liver temperature was 91.2 degrees F. Approximately how many hours ago did they die?
4.8= 5 hours
What lobe of the brain is more on top of the head and is responsible for sensory input and perception?
Parietal
Where on the body do we check heart rate? Where do we feel for heart rate?
Pulse points: radial pulse, brachial pulse, femoral pulse, carotid...
How old is someone usually when they are diagnosed with Type 1 diabetes?
Young- child, adolescent
What is an independent variable?
It's what the scientists are manipulating, like rooms with different temperatures and Reynaud's syndrome
What color will a positive Kastle-Meyer presumptive blood test turn the cotton swab?
Pink
What is the term for the pooling of blood after death?
Livor Mortis
What are some that someone would experience if they had a TBI (Traumatic Brain Injury)?
Headache, dizziness, confusion...NOT diarrhea!!
What number is on top of a blood pressure reading?
Systolic: when the heart is beating
What are the 3 components of a nucleotide?
Nitrogen base, phosphate group and deoxyribose
What is empathy?
Actually feeling the pain of others. You put yourself in their shoes.
What blood type will someone have who shows no agglutination (clumping) in any wells?
O neg
What is the term for the stiffening of the body after death?
Rigor Mortis
What side of the heart carries De-oxygenated blood? Right or left?
Right
What is the function of leukocytes (WBC)?
Immune protection against viruses, bacteria, etc...
What is the complimentary base pairing for the following RFLP (fragment)?
GGATC
CCTAG
Who gets type II diabetes?
Older adults who usually eat a poor diet and don't exercise enough.
What are the 3 components of a good crime scene sketch?
Sketch of crime scene, evidence log, and a legend
What is the term for the cooling of the body after death?
Algor Mortis
What blood vessel does oxygenated blood end up in before it is delivered to the rest of the body?
Aorta
What is the function of erythrocytes (RBC)?
Transports oxygen
Cut this RFLP (fragment) with the restriction enzyme HAEIII. It cuts between GG/CC:
AATTGAGGCCAATTCGTACGGCCTAGCG
How many fragments (RFLPs) are there?
3
What do we give someone whose blood sugar is too low?
Apple juice, Glucagon
How many minutiae points do you need for a positive match?
12
Give me an example of cause of death:
Gun shot wound, stab wound, fall...
What is the difference between CTE and TBI?
TBI- head injury in one occurrence
CTE- chronic head injuries that occur over time
What is the function of platelets?
Clots the blood
Match up the bands
Which cholesterol do we want low levels of in our blood? LDL or HDL?
LDL
Name 3 minutiae points:
Delta, eye, fork, double/triple fork, bridge, dot
What is a body farm?
A place where investigators can come and learn about decomposition of the human body. People donate their bodies to science and their remains and left out in the open in a forested area to study.
What does the septum separate in the heart?
Right and left sides of the heart
What is blood plasma?
Liquid portion of the blood that is made up of water, glucose, vitamins, minerals
What type of feedback loop is the blood glucose loop?
Negative
What is telehealth?
Healing at a distance: Zoom meetings with doctors and nurses, health care apps, glucometers