Calculate the Melting Temperature of the following primer:
GCGAGTTATGCAATAGAGCGC
64C
t(9;22)
Chronic Myelogenous Leukemia
What molecular technique is considered the gold standard for sequencing?
Sanger Sequencing
Triplet repeat expansion - CAG repeat within the HTT gene
Huntington's Disease
A positive result for HPV type 16 indicates
High risk for cervival cancer
Calculate the Sensitivity and Specificity for the following test:
100 validation samples were tested in total. There were 50 known positives and 50 known negatives. Of those 100 samples, 47 were correctly classified as Detected, 49 were classified as Not Detected.
94% = Sensitivity
98% = Specificity
t(11;14)
Mantle Cell Lymphoma
This type of PCR is done in two rounds; that is, the PCR product of round one is used as the template for round two.
Nested PCR
Point mutation
(1691A > G, R506Q)
Factor V Leiden
The gene that gives S. aureus penicillin resistance
mecA
Calculate the RNA concentration in ug/mL from the following information:
Absorbance reading at 260nm from a 1:100 dilution = 0.088
352
t(8;14)
Burkitt Lymphoma
ddATP=green, ddCTP=blue, ddGTP=black, ddTTP=red
What is the sequence for the following:
green, blue, black, black, blue, red, black, green, red, green, blue, black, black, blue, red, black, green, red
5' ACGGCTGATACGGCTGAT 3'
Karyotype:
47,XY, +18
Edward's Syndrome (trisomy 18)
Patients who maintain viral levels at fewer than ________ copies/mL in early stages of infection are at decreased risk of progression to AIDS.
10,000 copies/mL
How many copies of a target are made after 42 cycles of PCR?
2^42
4,398,046,511,104
t(8;21)
Acute Myeloid Leukemia
If a high concentration of NaCl was added to a hybridization solution, how would stringency be affected?
Stringency would be decreased.
Triplet repeat expansion in the FMR-1 (>200 repeats)
Fragile X Syndrome
A molecular assay that targets IS481 repetitive insertion sequence can be used to diagnose this infection:
bordatella pertusis (whooping cough)
The final concentration of Taq polymerase is to be 0.01 unints/uL in a 50-uL PCR. If the enzyme is supplied at 5 unites/uL, how much enzyme would you add to the reaction?
1uL of a 1:10 dilution
t(15;17)
Acute promyelocytic leukemia
In NGS adaptors may contain short sequences that can be used to identify the sample. This is known as…
indexing or barcoding
Karyotype:
47;XXY
Kleinfelter Syndrome
What Hepatitis C genotype is the most resistant to anti-retrovirals?
Genotype 1