The phase of the cell cycle in which the cell doubles its organelles and accumulates materials needed for DNA synthesis
What is the G1 phase?
The feature of DNA described by the fact that the DNA strands are oriented in opposite directions
The final product of mitosis
What are 2 diploid cells?
The final product of meiosis
What is 4 haploid daughter cells?
The process by which DNA is read and transformed into mRNA
What is transcription?
The three phases of translation
What are initiation, elongation, and termination?
The phase of the cell cycle in which DNA is replicated
What is the S phase?
This feature of DNA is described by the fact that adenine and thymine pair together, and cytosine and guanine pair together.
What is complementary base pairing?
The phase of mitosis in which sister chromatids separate
What is anaphase?
What is synapsis?
The reading of mRNA to form protein
What is translation?
A group of structure and regulating genes that function as a single unit in bacteria
What is an operon?
The phase of the cell cycle in which the cell synthesizes proteins needed for cell division and ensures DNA is done replicating
What is the G2 phase?
The enzyme responsible for unwinding DNA prior to replication
What is DNA helicase?
The phase of mitosis in which chromosomes begin to attach to the spindle via attachment to kinetochores
What is prometaphase?
The exchange of genetic material between non-sister chromatids of homologous chromosomes
What is crossing over?
The triplicate code that mRNA is read by
What are codons?
What is pre-transcriptional control?
The process that occurs if DNA damage is detected during the cell cycle that cannot be fixed
What is apoptosis?
DNA replication is called __________ because each DNA molecule contains one new strand and one old strand
What is semiconservative?
The phase of mitosis in which the nuclear envelope disintegrates
What is prophase?
Homologous chromosomes align across from one another at the metaphase plate - how each pair of chromosomes aligns is independent of the others - which is described by this term
What is independent assortment?
The location of transcription and translation
What is the nucleus (transcription) and the ribosome (translation)?
A permanent change in the sequence of bases in DNA that can impact how genes are expressed
What is a gene mutation?
The phase in which most of the cell cycle is spent
What is interphase?
The sequence of bases in the complementary DNA strand if one strand is 5' AGCGTC 3'
What is 3' TCGCAG 5'?
The phase of mitosis in which the nuclear envelope reforms after sister chromatids have separated
What is telophase?
This phase of meiosis is where homologous chromosomes begin to separate
What is anaphase I?
The form of RNA that brings amino acids to the ribosome during protein synthesis
What is tRNA?
Use the table provided:
Given this DNA sequence, give the protein sequence.
DNA: AAGATACCTGCGGGGGGTAATT

What is Met-Asp-Ala-Pro-His?
RNA: UUCU/*START*AUG/GAC/GCC/CCC/CAU/UAA