DNA Facts
3 Parts of a DNA nucleotide
What is deoxyribose sugar, nitrogenous based and phosphate group?
Order of the central dogma of biology
What is DNA --> RNA --> Protein
Larger fragments migrate...
What is slowly?
The number of bands created when you cut bacterial DNA with 2 restriction enzymes
What is 2 bands?
A plant that's sequence has been intentionally mutated
What is a GMO?
The direction DNA polymerase works
What is 5' to 3'?
Process of reading DNA to make mRNA
What is transcription?
Loaded into the first lane and acts as a marker of base pair length.
What is the DNA Ladder?
The number of bands created when you cut linear DNA with 5 restriction enzymes
What is 6 bands?
Jellyfish protein manipulated by scientist for easy visualization.
What is Green Fluorescent Protein?
Adenine and Guanine
What are purines - nitrogenous bases with double rings?
Process of using mRNA to synthesize proteins
What is translation?
The 3 reasons why bands separate on a gel
What is Size, Shape and Charge?
The bond that restriction enzymes break in the DNA
What is the phosphodiester bond?
Steps of PCR
What is 1) Denature - Heat up and separate the DNA strands 2) Anneal - cool down to attach the primers, 3) Extension - raise temperature to have taq polymerase extend the DNA
What type of cell contains DNA?
What is the genetic material in both eukaryotic and prokaryotic cell types
Amino acids joined by peptide bonds.
What are Proteins?
Due to the charge of DNA, DNA migrates towards...
What is The Anode?
The enzyme needed to glue back together cut fragments to form a recombinant plasmid
What is ligase?
Used to test diseases by recording the presence of antibodies.
What is an ELISA?
The DNA sequence that all coding regions begin with.
What is TAC?
Differences in DNA used to determine if a suspect was at the crime scene
What areDNA polymorphisms such as STR, vNTRs and RFLP?
The 3 steps required to create then transform a recombinant plasmid into bacteria
What is 1) Cut the plasmid and gene of interest with the same restriction enzymes 2) Mix together then heat shock 3) Grow on selective media (amp or X-gal agar)
The 4 base primers for amplification of both strands of 5' ACAATACGGGCTAGGATCGGTTCTGA 3'
What are 5' ACAA 3 and 3' GACT 5' '?