Organelles
What is the function of the mitochondria?
To produce ATP for the body's functions.
What are the 3 parts of the cell cycle?
Interphase, Mitosis, Cytokinesis
What is the goal of transcription?
To produce an mRNA molecule that can carry the DNA's message out of the nucleus.
What is the goal of translation?
To use the mRNA strand to produce a polypeptide.
What type of cell has a nucleus and membrane-bound organelles?
Eukaryotic cells
The ER sends carbs, lipids, and proteins throughout the cell, but the golgi apparatus is able to send materials out of the cell as secretions.
S phase of interphase
What are two structural differences between DNA and RNA?
DNA is double-stranded and has Thymine. RNA is single-stranded and has Uracil.
How does the ribosome recognize mRNA strands?
What types of cells are prokaryotes?
What organelle is full of digestive enzymes that helps recycle old and run down organelles?
Lysosomes
In what phase of mitosis are sister chromatids moved to the middle by microtubules?
Metaphase
Transcribe the following DNA strand.
ATTGCATCCTAGATGATATA
UAACGUAGGAUCUACUAUAU
How does the tRNA know where to bond to on the ribosome?
The codons on the mRNA strand.
A single-celled organism was found with chitin cell walls, ribosomes, and cilia. Is this a eukaryotic or prokaryotic cell?
Eukaryotic
What allows the cell to recognize foreign cells within the body?
The glycocalyx within the cell membrane.
What part of the cell cycle does the nuclear membrane begin to reform?
Telophase
What two things are added to the removed exons before the mRNA strand can leave the nucleus?
What are the 3 parts of a ribosome and what do their letters stand for?
E-Exit
A- Attachment
P-Preparation
Which structures, if found in a cell, would provide the best evidence that the cell is eukaryotic?
Chromosomes
Cell Walls
Carbohydrates
Internal membranes
Internal membranes
How does the function of the mitochondria differ from the function of the chloroplast?
The mitochondria breaks down glucose to make energy, and the chloroplast captures light energy to make glucose.
What is the result of one completion of the cell cycle?
2 genetically identical daughter cells.
What is the strand of DNA is used to synthesize the mRNA called?
Template strand
What does the tRNA do once it distributes its amino acid to the ribosome?
A single prokaryotic cell can divide several times in an hour. Most eukaryotic cells cannot divide this quickly. Why do you think this happens?
Eukaryotic cells are bigger and more complex than prokaryotes.