This is the term that describes the shape of DNA.
What is a double helix?
This is the longest part of the cell cycle, where cells grow and carry out their normal function.
What is interphase?
This term describes the first major part of protein synthesis.
These are the three main types of mutations.
What are point mutation/substitution, insertion, and deletion?
These are the monomers or building blocks of proteins.
What are amino acids?
These are the full names of each of the 4 types of nitrogenous bases.
What are Adenine, Guanine, Cytosine, and Thymine?
This is the phase in mitosis where chromosomes line up along the metaphase plate and spindle fibers attach to centromeres.
What is metaphase?
This is a group of three mRNA Nucleotides that code for a specific amino acid.
What are codons?
These are three possible results of mutations.
What is harmful, beneficial or neutral?
This is the original set of instructions for building any type of protein in the body.
What is DNA?
This is the term that describes the part of DNA shown below:

What is this?
What is a nucleotide?
This is the phase in mitosis where DNA in the form of chromatin condense into chromosomes, the nuclear membrane dissolves, and spindle fibers develop around centrioles toward opposite ends of the cell.
What is prophase?
This is a strand of codons that the ribosome reads to know which amino acids to link together.
What is mRNA?
These two mutations causes a shift in the rest of the codons in a gene.
What are insertions and deletions?
This is the main function of proteins in the body.
The part of DNA labeled as A in the diagram below:
What is a nitrogenous base
This is the phase in mitosis where chromosomes unwind into chromatin and a nuclear membrane re-forms.
What is telophase?
This would be the mRNA strand that would be transcribed from the DNA strand: TAC CGC TCC
mRNA:AUG GCG AGG
This is something that could cause a mutation in DNA.
What is inheritance / free radicals / radiation?
This is where the body gets new amino acids to build new proteins.
What is protein in the food we eat?
The part of DNA labeled as B in the diagram below:
What is a deoxyribose sugar
This is the part of the cell cycle where the cytoplasm and organelles split into two new daughter cells.
What is cytokinesis?
This is the location for translation.
What is outside the nucleus / in the cytoplasm / in the Rough ER?
Below is an example of this type of mutation:
Original DNA strand: TTACAATAGACGGTAAACT
Mutated DNA STRAND: TTACAATACGACGGTAAACT
Insertion Mutation
These are the types of bonds that connect amino acids.
What are polypeptide bonds?