DNA
RNA
DNA Replication
Transcription
Translation
100
What are Adenine, Guanine Cytosine, Thymine?
What is DNA Nitrogen Bases
100
What are Adenine, Uracil, Guanine, Cytosine?
What is RNA nitrogen bases
100
Breaks the hydrogen bonds, causing the DNA strand to separate
What is Helicases
100
Site where Transcription begins
What is Promoter site
100
What is the purpose of translation?
What is making a protein
200
The structure of DNA
What is Double Helix
200
mRNA, tRNA, rRNA
What is form of Messenger, Transfer, Ribosomal
200

Where does replication occur?

What is in the nucleus. 

200

What is made during transcription. 

What is mRNA.

200
The parts involved in Translation
What is mRNA strand, tRNA, amino acids, and ribosomes
300
What do Deoxyribose, Phosphate, and Nitrogen Base make? Be specific!
What is DNA nucleotide
300
What is Ribose and where is it found?
What is sugar found in RNA
300

What is the complementary strand to the following bases?

ATG CGA TTA CTA

What is

TAC GCT AAT GAT

300
Sequence of nucleotides that marks the end (stop) of a gene
What is Termination Signal
300
What does AUG code for?
What is the Methionine (Start Codon)
400
AGCAATTCCGGTAGTCGATA What is this called?
What is Base sequence/ DNA sequence (strand)
400
What does Ribose, Phosphate, and Nitrogen Base make?
What is a RNA nucleotide
400
Polymerase that add free complementary nucleotides to the original strands.
What is DNA polymerase
400
Breaks the DNA strands apart and adds free RNA nucleotides
What is RNA polymerase
400
The bond between amino acids (enzymes)
What is Peptide bond
500
Give me Pyrimidines and Purines
What is Thymine and Cytosine (Pyrimidines) Adenine and Guanine (Purines)
500
What is Uracil? Where is it found
What is the nitrogen bases that replaces Thymine in an RNA strand
500

In the "new" double helix one strand is from the original molecule and one strand is "new" what are these "new" strands called?

What is the daughter strand

500
After Transcription is finished what happens to the newly formed RNA strand? Where does it go?
What is goes out of the nucleus through the nuclear pores into the cytoplasm.
500
Name all the stop codons
What is UAA, UAG, UGA
M
e
n
u