DNA/RNA Structure
The name of the shape of DNA
What is a double helix?
What is DNA Replication
doubling the DNA in a cell for cell division
Transcription is going from ___ to ___
DNA to RNA
Translation takes place when an _____ binds to a _______.
Translation takes place when an mRNA binds to a ribosome.
The Primary structure of a protein is also called
Polypeptide chain
The four bases of DNA AND RNA
DNA-A, C, G, T
RNA-A, C, G, U
DNA Replication starts with...
DNA splits apart allowing room for DNA polymerase to come in
Transcription begins when
DNA splits and allows the RNA polymerase to come in and assemble the new RNA strand
What does tRNA do?
Brings in amino acids to bind together
The secondary structure is...
folded polypeptide chain
Complete the sentence: DNA is _________ stranded while RNA is __________ stranded.
DNA is double stranded while RNA is single stranded.
The enzyme that does all of the work in replication is called...
DNA Polymerase
The enzyme involved in transcription
RNA Polymerase
Formed by linking many amino acids together
Polypeptide chain
What two ways can we fold the polypeptide chain?
Pleated Sheet
Helix
A nucleotide is composed of what three things?
Sugar, Phosphate group, Base
What exactly does DNA polymerase do?
Brings in missing bases to create a new strand
Transcription results in what?
mRNA strand
What is a codon and an anticodon?
The codon is on the mRNA, it is three bases and codes for an amino acid.
The anticodon is located on the tRNA and allows the correct amino acid to be brought in.
This structure is composed of many helixes and sheet meshed together
Tertiary structure of protein
The type of sugar DNA uses in its back bone is:
Deoxyribonucleic acid
Create the complementary strand
AATCCGTTGACTTTTCGG
Transcribe this DNA sequence:
ATGCTGTGACTGCATGCCCATATT
Translate this sequence:
AAAUUAUGUUUCUGGUAAAUUGAUGGCC
START-Phe-Leu-Val-Asn-STOP
SOME proteins require a __________ structure. This is made of many __________ structures meshed together.
SOME proteins require a quaternary structure. This is made of many tertiary structures meshed together.