The Scientific Method/ Biological Organization
What are the steps of The Scientific Method
1.Observe and Generalize
2. Formulate a hypothesis
3. Make a testable prediction
4. Experiment and observe
5. Modify the hypothesis and retest as needed
What are the 3 requirements in the cell theory that all cells must meet?
1.All living organisms have at least one cell
2.The cell is the smallest unit in the characteristics of life
3.All cells come from preexisting cells
What are Nucleotides
The building blocks of DNA
(adenine, thymine, Cytosine, Guanine)
Metastasis is when________
a. Normal cells have mutated and altered their growth and division rates
B. Normal cells that are responsible for basic cellular functions are mutated
c. Cancer cells break away from the main tumor and develops new colonies of cells at distant sites of the body
d. Cancer cells active or repress the expression of other genes
c. Cancer cells break away from the main tumor and develops new colonies of cells at distant sites of the body
What is Gene Therapy?
an experimental technique to treat or prevent
genetic diseases. Allows doctors to treat a disorder by: inserting a gene into a patient’s cells
What are the Defining Features of Humans
•Bipedalism
•Large brain
•Capacity for complex language
•Opposable thumbs
What are the two phases of The Cell Cycle?
Cytokinesis (cytoplasmic division) and Mitotic Phase (nuclear division)
Finish the base pair sequence
ACATTAGGATTCTATTACCA
TGTAATCCTAAGATAATGGT
Proto-Oncogenes are ______________
a. Normal genes that promotes cell division and tissue growth
b. Abnormal genes that control cell division and tissue growth
c. Mutated oncogenes
d. Genes that slow down cell division
a. Normal genes that promotes cell division and tissue growth
List 3 diseases that would be a good candidate for gene therapy.
Cystic Fibrosis
Sickle Cell Disease
Huntington's Disease
What are the major characteristics of life?
1.Have different molecular compositions than nonliving things
2.Living things require energy and raw materials
3.Living things are composed of cells (unicellular & multicellular organisms)
4.Living things maintain homeostasis
5.Respond to external environment
6.Grow and reproduce
7.Populations of living things evolve
At which point in the cell cycle are cells the smallest?
A. The beginning of G1
B. G2 phase
C. The beginning of Mitosis
D. S phase
A. The beginning of G1
What makes up the backbone of a DNA molecule?
Phosphate groups
_______ is a tumor suppressor gene that halts the cell cycle at the G1 check point and prohibits cancerous cells from dividing
a. BRCA2 Tumor suppressor gene
b. BRCA1 Tumor suppressor gene
c. P51 Tumor suppressor gene
d. P53 Tumor suppressor gene
d. P53 Tumor suppressor gene
what are some obstacles to gene therapy?
1. Getting the corrected gene into adult somatic cells is difficult
2. Even if successful for the person being treated, it won’t get the corrected gene into offspring.
When Developing a hypothesis, you use…
Observations and Inductive reasoning
For cells to properly reproduce, they need________________.
A. Genetic material, lipid bilayer, organelles
B. Carbohydrates, lipid bilayer, genetic material
C. Organelles, Lipid bilayer, nuclear membrane
D. Lipid Bilayer, nuclear membrane, sister chromatids
A. Genetic material, lipid bilayer, organelles
What makes up a DNA molecule?
•5- carbon sugar
•Base (A, T, C, G)
•Phosphate group (P)
Name three ways cancer can be diagnosed and list examples of each.
1. Tumor imaging
X-rays, PET, MRI
2. Genetic testing
looks for mutated genes
3. Tests for cancer markers
Blood screening
List 3 Common forms of gene therapy
1. Plasma DNA
2. Viral vectors
3. Bacterial vectors