EO9
During what phase of mitosis do the chromosomes line up down the middle
Metaphase
Define transcription
Transcription- copying a segment of DNA into RNA
What is provided by metabolic pathways that is essential for the survival of all cells?
Energy
What is the name of the triplet nucleotides that code for amino acids?
Codons
What step of cellular respiration results in the most ATP?
ETC
What enzyme works to replicate the DNA?
DNA polymerase
Define translation
Translation- ribosome synthesizes proteins (takes RNA and codes it)
What is a metabolic pathway?
Metabolic pathways refer to the sequence of enzyme-catalyzed reactions that lead to the conversion of a substance into a final product.
What are the inputs and outputs of photosynthesis?
In: Light energy, CO2, H2O
Out: glucose, O2
What are the inputs and outputs of cellular respiration?
In: glucose, O2, ATP
Out: CO2, H2O, more ATP
During what phase of the cell cycle does DNA replication occur?
Where does most protein synthesis occur in eukaryotic cells?
Cytoplasm
What is a catabolic pathway?
catabolic- The stage in metabolism during which external material is broken down into parts and energy from the external material is transferred to high-energy molecules in a cell.
Draw a cell in metaphase of mitosis. (2n=6)
Drawn
What type of cells are the result of mitosis?
Somatic (body) cells
What is the goal of mitosis?
The goal of mitosis is to create two daughter cells that will inherit an equal and identical complement of chromosomes (create genetically identical daughter cells)
What is the central dogma of molecular biology?
DNA-> RNA -> Protein
What is an anabolic pathway?
anabolic- The stage in metabolism during which the energy from cellular high-energy molecules is used to assemble the parts into biomacromolecules, cellular structures, and ultimately cells (biomass).
How do you track carbons through cellular respiration?
Glucose (6) -> 2 pyruvate (3 each) -> 2 acetyl coA (2 each) and 2 carbon (released) -> additional 4 carbon released
Where does photosynthesis occur? How does this differ from cellular respiration?
Photosynthesis: Chloroplast
Cellular respiration: Cytosol, Mitochondria
Replicate the strand below. Accurately label both strands, including what type of genetic material it is.
3’- ATCGGGCCTTACGTCTAGATCATCAGACTCTGCG -5’
3’-ATCGGGCCTTACGTCTAGATCATCAGACTCTGCG-5’
5'-TAGCCCGGAATGCAGATCTAGTAGTCTGAGACGC-3'
Replicate the strand below. Accurately label both strands, including what type of genetic material it is.
3’- ATCGGGCCTTACGTCTAGATCATCAGACTCTGCG -5’
How does this fit into the central dogma of molecular biology?
DNA (no U)
DNA Replication (semi-conservative process before transcription or translation occur)
Draw out and label the catabolic and anabolic pathways involved with cellular respiration. (Model from study guide)
Drawing
What are the three types of RNA and what are their roles in a cell?
mRNA- Messenger RNA that carries the genetic info to make proteins
rRNA- ribosomal RNA helps make ribosomes
tRNA- transfer RNA translates the genetic info into protein sequence
Replicate the strand below. Accurately label both strands, including what type of genetic material it is.
3’- AUCGGGCCUUACGUCUAGAUCAUCAGACUCU -5’
How does this fit into the central dogma of molecular biology?
RNA (U)
This could be the resulting mRNA strand after transcription or the mRNA strand that will be translated into a chain of amino acids (protein) (either answer is correct)