Which is true of DNA?
A. The nitrogenous bases are exposed to the outside of the double helix
B. The only type of bonds that hold together the two strands are hydrogen bonds
C. It is made up of two strands, held together by strong hydrogen bonds
D. The phosphate groups are inside of the double helix structure
C. It is made up of two strands, held together by strong hydrogen bonds
What is the role of helicase in DNA replication?
break the hydrogen bonds between bases unzipping the DNA to allow replication to occur
What enzyme adds free nucleotides to the growing mRNA during transcription? Note: this enzyme also unwinds the double helix during transcription.
RNA polymerase
Which type of RNA carries an amino acid to the ribosome?
tRNA
DNA can become damaged by
•Chemicals
•Radioactivity
•X-rays
•Ultraviolet (UV)
•Chemicals in cigarette smoke
What is the main difference between the 4 DNA nucleotides?
a. Only the nitrogenous bases are different
b. They are all identical
c. Only A and T have a phosphate
d. Some contain ribose and some contain deoxyribose
a. Only the nitrogenous bases are different
DNA replication occurs during which part of the cell cycle?
A. Interphase G1
B. Mitosis
C. Interphase S phase
D. Anaphase
Interphase S phase
RNA polymerase continues until the ____________________ is reached.
terminator
Proteins are link between _____________ & ________________ - determine what traits show up in the offspring.
genotype; phenotype
A point mutation that results in a stop codon.
Nonsense mutation
A nucleotide is composed of:
A sugar, a phosphate group, and a nitrogenous base
If a parental DNA strand has the following sequence: TTTACGCA, what is the sequence of the complementary daughter strand?
AAATGCGT
A promoter is the region of a gene where ________________________ begins.
transcription
Ribosomal RNA (rRNA) – forms part of the ribosome - binds the tRNA and the mRNA to the ribosome.
A point mutation that results in a codon that indicates a different amino acid.
Missense mutation

In the diagram, _______________ bonds hold A and T together while ______________ bonds hold sugar and phosphate groups together.
hydrogen, covalent
Which enzyme is responsible for proofreading the daughter strands?
a. Polymerase
b. None of the answers are correct
c. Primase
d. Helicase
e. More than one of the answers is correct
a. Polymerase
From the following DNA sequence, transcribe the mRNA molecule:
CATGGTATGGATCCC
GUACCAUACCUAGGG
Identify the tRNA anticodons from the following mRNA sequence:
AAG CUA AUC
UUC GAU UAG
A mutation that involves one nucleotide is called
a. a mutagen.
b. an inversion.
c. a point mutation.
d. a translocation.
c. a point mutation.
Which two bases are the double ring structures? Name this group.
Guanine
Adenine
Purines
If a dolphin's DNA contains 15% guanine, what percentage of the DNA is made up of adenine AND thymine?
70%
Which part of gene expression is shown in this image?

transcription
Use the codon wheel to identify the amino acid sequence from the following mRNA molecule:
AUGCGCGGAUCCCCCACCUAG

Met-Arg-Gly-Ser-Pro-threonine-stop
During G1, a cell is exposed to radiation which causes a cytosine to change to uracil. What process will be used to repair the damage?
a. The uracil will change back to cytosine on its own
b. Mismatch repair
c. The DNA cannot be repaired
d. Proofreading
d. Proofreading