DNA/RNA
The monomer of DNA and RNA are ________.
nucleotides
What is the Central Dogma of genetics?
DNA ----> RNA -----> protein
How many gametes are created from 1 cell in meiosis?
4
What is a homozygous dominant genotype?
AA (two capital letters)
The insertion or deletion of a nucleotide.
The three parts of a nucleotide are:
Sugar, Phosphate, Nitrogen base
What is the role of tRNA during protein synthesis?
To bring amino acids to the ribosome.
During what phase in meiosis do homologous chromosome pairs get separated?
Anaphase I
What genotypes show the dominant trait?
homozygous dominant (AA) and heterozygous (Aa).
What is a mutation? What are the two main types of mutations?
Mutation: a change in the DNA
Two main types: gene and chromosomal
In a DNA molecule, A binds with ____ and C binds with ____. The nitrogen bases are held together by what type of bond?
T, G
Hydrogen bond
The process of making mRNA from DNA is called ________. Making a polypeptide from mRNA is called ________.
Transcription
Translation
Fill in the blanks with either haploid or diploid:
During meiosis I, a _______ cell divides into two _______ cells.
During meiosis II, two ________ cells divide into four _________ cells.
diploid, haploid, haploid, haploid
When a homozygous dominant parent is crossed with a homozygous recessive parent, what percentage of the offspring show the dominant phenotype? What percentage showthe recessive phenotype?
100% show the dominant and 0% show the recessive.
This type of mutation results in multiple copies of the same gene. Is this a gene or chromosomal mutation?
Duplication
Chromosomal mutation
The shape of a DNA molecule is known as:
a double helix.
Where in the cell do transcription and translation occur?
Transcription: the nucleus
Translation: the cytoplasm on a ribosome
Name 2 differences between mitosis and meiosis.
Mitosis is for growth and repair; meiosis is for creating gametes (sexual reproduction.)
Mitosis involves one division; meiosis involves two divisions.
Mitosis results in genetically identical daughter cells; meiosis results in genetically unique daughter cells.
Mitosis takes place in somatic cells; meiosis takes place in germ line cells.
Mitosis happens all over the body; meiosis only happens in the gonads.
A diagram that shows the probability of inheriting traits from parents with certain genes is a ______ ______. When we look at a single trait, it is called a ___________ __________.
Punnett Square
monohybrid cross
This type of inheritance pattern shows equal males: females, is common, and never skips generations.
Autosomal dominant.
Name three differences between DNA and RNA.
1) DNA has deoxyribose sugar and RNA has ribose.
2) DNA has thymine and RNA has uracil.
3.) DNA is double stranded and RNA is single stranded.
Transcribe and translate the following DNA sequence:
ACTACGGGCTTCGACATTAG
mRNA: UGAUGCCCGAAGCUGUAAUC
a.a.: met-pro-glu acid-ala-val-iso
Name 2 events in meiosis that create new genetic combinations.
1) Crossing over during prophase I
2) Random chromosomal alignment during metaphase I
3) Random chromosomal alignment during metaphase II
What is the genotypic ratio of a cross of two heterozygous parents?
1 homozygous dominant: 2 heterozygous: 1 homozygous recessive
The 3 questions you ask to determine the inheritance pattern of a trait.
1. What is the male:female ratio of affected individuals?
2. Is the trait rare or common?
3. Does the trait skip generations?