Pedigrees/Mendel's Laws
What is the defining characteristic of autosomal recessive mode of inheritance pattern in a pedigree?
What is skips a generation and has ~ equal numbers of affected males and females?
What is a mutation?
What is a change in the base pair sequence?
Show picture.
What section contains the promoter? What section contains the enhancer?
What is D and A?
What disease is maternally imprinted?
What is Prader-Willi Syndrome?
A population of snakes are found on an island in Lake Eerie. Some of the snakes are banded and some are unbanded; banding is caused by an autosomal allele that is recessive to an allele for no bands. The frequency of banded snakes on the island is 0.04, whereas the freqeuncy of banded snakes on the mainland is 0.64. Summer 2014, a large number of snakes migrate from the mainland to the island. After this migration, 20% of the island population consists of snakes that come from the mainland. If both the mainland population and the island population are assumed to be in Hardy-Weinberg
equilibrium for the alleles that affect banding, what is the frequency of the allele for bands on the
island and on the mainland before migration?
What is q = 0.2 on the island and q = 0.8 on the mainland?
Pedigree put on board
What is X-linked dominant?
Which type of mutaion is least likely to revert?
What is deletion?
What happens when you don't include a dNTP in Sanger Sequencing?
What is only the peaks including the first N nucleotide are shown?
Complementation Table
How many complementation groups are there?
What is 5?
At a given locus, two alleles, 1 and 2, are present in a popula%on in Hardy-Weinberg equilibrium and no
other alleles are present at appreciable frequencies. Homozygotes for allele 1 represent 49% of the
popula%on. What frac%on is heterozygous?
What is 42%?
Cats carrying a single copy of an allele (T’) are tailless. T’ is lethal in the homozygous condition. TT cats have tails. If you cross two manx cats (TT’), what proportion of the offspring do you expect to be tailless?
What is 2/3?
List the three gain-of-function mutations.
What is hypermorphic, neomorphic, and antimorphic?
5’gcatgat accaaatgcg aagagggacg cgtgactgaa gcacccctgg gttag 3’
Using the DNA sequence shown, construct an 8 bp primer pair to amplify the region.
What is 5' gcatgata 3' and 5' ctaaccca 3'
What happens when you don't include a ddNTP in Sanger Sequencing?
What is there would be no N peaks?
Can tumor-suppresor genes display a dominant inheritance pattern? Why or why not?
What is yes because of loss of heterozygosity?
A farmer crosses a true-
breeding orange pumpkin with a true-breeding white
pumpkin, and all the F1 pumpkins are orange. When she crosses the F1 progeny, she finds the following in the F2:
179 orange pumpkins
61 green pumpkins
58 yellow pumpkins
20 white pumpkins
How many genes are involved in the inheritance of pumpkin color? What is this type of interaction called?
What is 2 and additivity?
A dominant allele of CONE that results in receptor
expression and signaling in a new tissue compared to wildtype. What are two terms you would use to describe this allele?
What is gain of function and neomorphic?
A long bristle, gray bodied ( s+e+/s e) fly produces offspring with a short bristle ebony body fly (s e/s e) fly. The offspring are
537 long bristle, gray body
542 short bristle, ebony body
76 long bristle ebony body
75 short bristle, gray body
What is the map distance between genes "s" and "e"? [Map distance = (the number of recombinants) divided by (the total number of progeny) x 100.]
What is 12.3 m.u.?
The arginine synthesis pathway requires the function of four enzymes. Below is the pathway with lines indicating where an enzyme would function to get to the next product in the pathway. Using information from the supplementation experiment data table, what is the order of enzymes in the arginine biosynthetic pathway from left to right?
N-Acetylornithine --> Ornithine --> Citruline --> Arginosuccinate --> Arginine
Show supplementation table
What is Arg E, Arg F, Arg G, and Arg H
In humans, albinism (unpigmented skin, hair, and eyes) is due to an enzymatic deficiency, and it is an
autosomal recessive trait. Suppose that in a small country of one million people (“Generation 1”), there
are 500 aa albinos and 9000 Aa heterozygous carriers. Calculate q.
What is 0.005?
In werewolves, the H allele dictates shaggy fur and the T allele dictates tipped ears. You cross a true-breeding shaggy fur, tipped ear werewolf with a true-breeding werewolf with smooth fur and rounded ears. All the F1s have shaggy fur and tipped ears. When the F1s are testcrossed, the progeny are as follows:
72 shaggy fur, tipped ears
78 smooth fur, rounded ears
76 shaggy fur, rounded ears
74 smooth fur, tipped ears
Describe the relationship between H and T.
What is unlinked?
Charlie Weasley is studying a gene in dragons that controls wing size. The wild type version of this gene is 120 amino acids long (“SW”). Treatment of dragon cells with the mutagen EMS (which induces substitution mutations) created a mutant version of the gene which is 150 amino acids long (“SW150 ”).
The N terminus and C terminus of the wild type and mutant protein sequence are identical. However, the extra 30 amino acids found in the middle of mutated version of the protein does not correspond to any sequence found in the wild type protein.
Would the length of the DNA sequence of SW
differ between the wild type and SW150 mutant
versions and why?
What is no because the mutations are DNA substitutions?
A specific transcription factor, Ursa, is an
activator that binds the enhancer of the Non gene. Another transcription factor, Zod, is a repressor that inhibits Ursa’s activity. Researchers were interested in how Zod may inhibit Ursa, so they obtained the amino acid sequence of Zod and analyzed it for common motifs. They discovered Zod has a leucine zipper dimerization domain. A DNA binding domain was not present. Given this information, write a 1 sentence hypothesis that mostly likely describes how the repressor Zod inhibits the activator protein Ursa.
What is Zod physically binds Ursa directly [forms a heterodimer with Ursa] and prevents Ursa
from interacting with the enhancer?
Show table
Draw the biochemical pathway.
What is mut4, 1, 5, 2, 3?
What is nougat, caramel, sugar, chocolate, peanuts, snickers?
Recall that sgRNAs for CRISPR/Cas9 have a 20 nt sequence that is identical (or nearly identical) to a 20-bp sequence in the genome you want to modify. Recall also that for Cas9 to cleave the DNA, that 20-bp sequence must be followed immediately in the genomic DNA by the sequence 5'-NGG, which is called a "PAM site". Cas9 then cleaves both strands of DNA between the bases 3 and 4 bp upstream of (5' to) the PAM site. You are designing an sgRNA that will bring Cas9 protein to the following site in genomic DNA where you want to correct a disease allele by knocking in a wild-type allele. What sequence would you use for the sgRNA?
5' TTCGCGTAAATTCGTCGTAACTCTAGGTG 3'
3' AAGCGCATTTAAGCAGCATTGAGATCCAC 5'
What is 5’-CGUAAAUUCGUCGUAACUCU-3'?