N-Bases
This base is only found in RNA
What is uracil
The resulting molecule after transcription
What is mRNA
The three types of RNA used in translation
What is mRNA, tRNA, and rRNA
The three components found in a nucleotide
What is a phosphate group, a sugar, and a base
The typical structure of a prokaryotic chromosome
Always pairs with guanine
what is cytosine
Location of transcription for a eukaryotic cell
What is the nucleus
Set of 3 nucleotides in sequence on mRNA
What is a codon
The complimentary DNA strand of the strand below:
3' ACAGGCTACTGCATT 5'
What is 5' TGTCCGATGACGTAA 3'
The feature that makes 2 different chromosomes homologous
same genes in the same locations
Form 2 hydrogen bonds when they complimentary base pair
What are adenine and thymine
In eukaryotic cells, what must occur after transcription before the mRNA can be translated?
What is RNA splicing (removing introns, adding poly-A tail...)
This happens to mRNA after translation has occurred
What is degrade
Where RNA can be found in a eukaryotic cell
What is the nucleus and the cytoplasm
The protein that DNA wraps around to form a nucleosome
what is a histone
These bases are purines
What are adenine and guanine
Enzyme responsible for the production of mRNA in transcription
What is RNA polymerase II
The resulting polypeptide after translation of the following mRNA strand
5' AGCAAUGCCCUAAGGUACGCAAUUAG 3'
What is Met-Pro
The carbon that is missing oxygen in deoxyribose
What is the 2' carbon
The relationship among DNA, a gene, and a chromosome
A chromosome composed of DNA and contains many genes
N-bases with only a single ring
What are pyrimidines
RNA strand hangs freely as it is being transcribed, upon completion the transcription complex falls apart and the RNA is separated from...
What is DNA template?
The following template strand of DNA is transcribed.
5' AACATACTTAGGCCATTAGGCGA 3'
What would the resulting polypeptide be?
What is Met-Ala
The number of hydrogen bonds between the following sequence of nucleotides and it's complimentary strand:
ATTCCGATCAGGGACTAAATCGGA
What is 59
The area where kinetochores are found