Vocabulary
One allele completely masks the effect of the other allele
What is Complete Dominance
The difference of Mitosis and Meiosis
Mitosis is how new body cells are produced, whereas meiosis is used to produce gametes
This type of dominance is shown with the cross of a tall and short plant TT x tt producing all tall plants
Complete dominance
is produced by the MRNA sequence AUG
What is Methionine(MET)
This is a mutation
What is a change in the DNA sequence of an organism
When both alleles are simultaneously expressed in the heterozygote
What is Codominance
The cell cycle with the stages of Mitosis
What are interphase, prophase, metaphase, anaphase, and telophase, and cytokinesis
what are the offspring of a incomplete dominance cross between a red homozygous dominant and a White homozygous recessive plant
all pink offspring
is created using the codon UGG
What is Tryptophan (Trp)
Three main types of mutations
What are substitutions, deletions, and insertions.
a variant form of a gene
What are alleles
two identical daughter cells, genetically identical to the original cell
What are the products of Mitosis
What is the genotypes and phenotypes and odds of the following cross
A cross between a bear heterozygous for Black fur and Bear homozygous recessive for Brown fur(b)
Genotypes Bb(50%),bb (50%)
Phenotype black 50% brown 50%
produced by the MRNA sequence
AUG, UGG, GCA, CUA, CAU, UAA
Methionine(Met), Tryptophan (Trp), Alanine (Ala), Leucine (Leu), Histidine (His), stop
A frameshift occurs beacuse of the two types of mutations
deletions and insertions
a form of Gene interaction in which both alleles of a gene at a locus are partially expressed, often resulting in an intermediate or different phenotype
what is Incomplete dominance
The products of Meiosis
What are four haploid daughter cells
with the cross of a mother that is a carrier and a father that does not have hemophilia what are the odds a daughter has hemophilia what is the odds a son does not have hemophilia
Daughter - 0%
son - 50%
This MRNA sequence is created from the DNA sequence ATCGATCGATGATGCTAGCTAGCT
What is UAGCUAGCUACUACGAUCGAUCGA
this occurs if the mutation changes the amino acid
this occurs if the mutation codes for a Stop
this occurs if the mutation codes for the same amino acid
what is a Misssense mutation
what is a nonsense mutation
what is a samesense mutation
This genetic variation of a gene is often represented by bloodtyping
what is Multiple alleles
This leads to genetic variations between generations
what is crossing over during prophase I
When crossing two heterozygous tall green pea plants what are the possible phenotype and at what ratio
the recessive traits are short and yellow
Tall and Green 9
Tall and Yellow 3
Short and Green 3
Short and Yellow 1
Is produced by the following DNA sequence
TAC,AGT,GGG,CCC,TTC,ACT
What is Methionine(MET), Serine(Ser),Proline (Pro),Glycine (Gly),Lysine (Lys),STOP
If there is a insertion of a G after the 4th MRNA base what will occur
AUG U AAGCUAGUAGCUGAUCGUAGCUACUG
A Nonsense muation will occur stoping the production of amino acids