Culture-dependent methods
Number of culturable microorganisms
What is < 1%
BOD test
What is the amount of oxygen consumed by bacteria during the assimilation (decomposition) of the organic material present in the water?
In nucleic acids based methods, it is often more important to identify the .......... than to .........
What are genes and isolate microorganisms?
DNA consists of two strands of
What is deoxyribonucleic acid (DNA)?
You can isolate microorganisms from a very small amount and dilutions are needed.
What is soil environment?
The samples are prepared in 10-fold dilution series, 1 mL of sample is inoculated in triplicate, growth is determined by measuring turbidity, and estimates of cell numbers are made using statistical tables.
What is MPN Technique?
Two elements that have proven especially useful for stable isotope studies
What are carbon and sulfur?
DNA nucleotide structure
What is pentose sugar, organic base, and phosphate moiety?
DNA replication proceeds
What is from 5’ to 3’ end?
Membrane filtration and preconcentration may be required
What is for the isolation of microorganisms from aquatic samples?
MSR growth medium is used to grow Lactobacilli. The typical pH for the medium is 6.2.
What is a selective medium?
The type of media used to isolate microorganisms resistant to penicillin
What is selective media?
The difference between DNA and RNA
What is the attached hydrogen/hydroxide (DNA/RNA) ion to the second carbon on the pentose sugar?
The first column of the agarose gel
What is DNA ladder/DNA template?
The predominant microorganisms in the low subsurface soil environment.
What are autotrophs?
MSR growth medium is used to grow Lactobacilli. The typical pH for the medium is 6.2. This medium will allow the growth of enterococci as well. Therefore, sorbic acid is added to decrease the pH= 5.0 and prevent the growth of enterococci.
What is an elective medium?
Method for detecting the forward reaction C6H12O6 = 2C2H5OH + 2CO2
What is measuring the amount of ethanol and CO2 produced as well as any intermediate compounds?
Nucleotides in RNA
What are Adenine (A), Guanine (G), Uracil (U), and Cytosine (C)?
Terminal Restriction Fragment Length Polymorphism (TRFLP) process
What is extracted DNA from samples is digested with restriction enzymes generating restriction fragments that will be viewed as bands separated by their length on an agarose gel
Restriction enzymes source
What are enzymes naturally present in bacterial cells which function is to destroy foreign DNA by cutting it into small pieces?
Techniques for enhancing culturability of microorganisms (make sure you know to explain why they help)
What are proper dilution methods, extended time for growth, co-cultures, gel microdroplets?
Carbon dioxide is utilized in aerobic processes (think which one) and produced in anaerobic processes (think which one). It is also present in the air. Design a microbial ecology experiment in which you can determine the source of dissolved CO2 in water which will be used by aerobic organisms.
What is you need to figure this one on your own?
The RNA sequence that complements the single strand of DNA 3'GGAGACTTACACGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG 5'
What is 5'CCUCUGAAUGUGCCUUUCUCUAAGUCCUAAGUCCUCCGGAUGGUACUUCUAGUUC3'?
DNA replication starts with this -----and it is short-chain of -----
What is primer - RNA?
Mode of action of restriction enzymes
What is the restriction enzyme binds to the sequence, scans the DNA, stops where it is able to bind to the recognition site, disrupts the hydrogen bonds of the complementary base-pairs, and thus cuts the DNA?