This search method is best in outdoor areas with defined boundaries.
This refers to the innermost core of the hair which some people lack.
Medulla
What is the formal name and purpose of red blood cells?
Carry oxygen
Name of the sugar that forms the primary structural component of DNA?
Deoxyribose
The term for the process of viewing DNA as it passes through an electrically charged gel.
Electrophoresis
A polygraph specifically measures these vital signs (3)
Heart Rate, Blood Pressure, Respiratory Rate
This fingerprint pattern is referred to as what?
Whorl
Any substance which the causes the body to have an immune response is known as what?
Antigen
This molecule provides the structural backbone of DNA (outermost).
Phosphate
DNA Ladder
This is a chosen point within a crime scene from which you take measurements from in a wheel or link method.
Critical Point/Point of Origin
This part of the hair is chemically stained when hair is dyed, causing the appearance of a different color.
Cortex
A kastle-meyer test presumes the presence of blood. What do we refer to this type of test as? (to see whether a substance is present or not?)
Presumptive
Cytosine
Thymine
In which way does DNA flow in an electrophoresis?
- to +
A relevant question in a polygraph to see the affect of the change is equivalent to what part of an experiment?
Variable
The outermost portion of the hair. Can be rough or smooth which determines hair texture.
Cuticle
Which blood type is considered a universal receiver? Can receive any blood type
AB+
The following DNA fragment is cut with the HindIII Enzyme.
How many fragments are formed?
ATTGACCAAGCTTAAGCCCAAGCTTAATTGGG
3
In an electrophoresis result, larger base pair fragments will be closer to which end of the electrophoresis gel?
- side (towards the top)
Something you do not change in an experiment which acts as a standard of comparison for results
Control

The specific details, such as those labeled above, in a fingerprint are referred to as what
Minutiae
You see the following results from an antibody treatment test (+ indicates agglutination):
Antibody A: -
Antibody B: +
Anti-RH: +
Which blood type is present? (include Rh factor)
B +
The process of copying DNA fragments into thousands of pieces for further analysis is known as what?
Polymerase Chain Reaction (PCR)
According to the following result, which Lane in the electrophoresis is the closest match to the crime scene?
Lane 2