Transcription
Transcription
What is the synthesis of mRNA using DNA as a template?
The four bases of DNA and RNA
What are adenine, guanine, thymine, cytosine? and
What are adenine, guanine, uracil, cytosine?
Translation
What is the synthesis of a protein using mRNA as a template?
The organelle that produces secretory granules
What is the Golgi body (apparatus)?
mRNA codons only code for one specific amino acid
What is unambiguous?
The enzyme that synthesises the mRNA from the DNA template strand
What is RNA polymerase?
The shape of DNA
what is a double helix?
Where translation occurs in a eukaryotic cell
What is the cytoplasm or ribosome?
The name of the active transport process that exports large molecules out of the cell
What is exocytosis?
The part of a tRNA molecule that recognises the mRNA triplets
What is an Anticodon?
The complementary mRNA transcribed from this template
TACGGATACCCAAATTGAATT
What is AUGCCUAUGGGUUUAACUUAA ?
The type of chemical bond (reaction) that connects nucleotides (sugar-phosphate)
What is a condensation polymerisation?
The translated amino acid sequence for the following mRNA sequence? AUG CCU AUG GGU UUA ACU UAA
met –pro –met –gly–leu–thr–stop
The name for each side of the golgi (where proteins enter and exit)
What are the cis and trans sides of the Golgi
The best Biology teacher at Star
Who is "all of them!"
Where transcription occurs in a eukaryotic cell
What is the nucleus?
The type of bond that joins the complementary bases two strands of DNA to each other
What is a hydrogen bond
The role of tRNA
What delivers amino acids to the ribosome?
The shapes that polypeptides form in secondary structures.
What are
Alpha helices
Random Coils
Beta pleated sheets
A difference between DNA molecules in prokaryotes and eukaryotes
What are linear chromosomes in eukaryotes and circular chromosomes in prokaryotes.
Draw the basic process of transcription. Label the following three components: DNA, RNA polymerase, mRNA
Answers will vary
Draw and label the three components of a DNA nucleotide?
What are
phosphate group
deoxyribose sugar
nitrogenous base
Draw and label a diagram of translation. Include the following: mRNA, codon, anticodon, tRNA, amino acid
answers will vary
The type of structure formed when 2 or more polypeptides combine to make a functional protein (spelling matters!)
What is a Quaternary structure
What is rRNA and where is it made?
What is ribosomal RNA? and what is the nucleolus?