Prokaryotes vs Eukaryotes
Where does transcription and translation occur in prokaryotes and in eukaryotes?
Prokaryotes: Translation and transcription both occur in the cytoplasm.
Eukaryotes: Transcription occurs in the nucleus and translation occurs in the cytoplasm.
What are the 4 components of a ribosome?
-Large subunit
-Small subunit
-tRNA
-mRNA strand
What is the first step of initiation in transcription and what does this recruit?
Transcription factors bind to the promoter region of the gene and this eventually recruits RNA polymerase allowing the RNA to be synthesized.
What are the three types of post-transcriptional modifications that occur in eukaryotes?
- 5' cap (modified guanine nucleotide)
- Poly A tail (adenine added to 3')
- RNA splicing
What are the two big categories in metabolism?
Anabolic and catabolic
How does the fact that both translation and transcription occur in the cytoplasm in prokaryotes affect gene expression?
Transcription and translation occurs simultaneously.
What are two things tRNA brings in during translation?
An amino acid and anti codon sequence
What is the idea behind the wobble effect?
Allows for flexibility in base pairing between the third base of codon and first base of an anticodon.
Describe the flow chart of the central dogma?
DNA-->mRNA-->Peptides/proteins
What is an open system?closed system?isolated system?
Open System: Exchange of matter and energy
Closed System: No exchange of matter but exchange of energy
Isolated System: No exchange of matter and energy
What type of RNA is produced during elongation of transcription?
mRNA, tRNA, and rRNA
What is the purpose of translation?
The production of a chain of amino acids!!
Which DNA strand would be used as the template strand if transcription is occurring from left to right?
Top strand: 5' ACCGTCATGGC 3'
Bottom Strand: 3' TGGCAGTACCG 5'
Bottom Strand
In what direction does RNA polymerase build and read?
Reads=> 3' to 5'
Builds=> 5' to 3'
If a ball is at rest at the top of a hill but is kicked causing it to roll down the hill. What type of energy would have been seen when the ball was at the top of the hill and when it was rolling down the hill.
Potential and kinetic energy respectively.
What is the benefit of eukaryotes performing RNA splicing after transcription?
This allows them the ability to remove introns from the pre-mRNA to create a mature mRNA molecule, which can then be translated into a protein.
During termination of translation once the stop codon is found, what is the complementary sequence that is brought in by tRNA?
NONE!! There is no tRNA with an anticodon that is complementary to the stop codons.
What are the three stop codons?
UAG
UAA
UGA
What is the start codon and what amino acid does it occur in?
AUG and methionine
What are characteristics of anabolic and how do they differ when compared to catabolic?
-Anabolic is the synthesis of complex molecules and it requires an input of energy to do this
-Catabolic energy is the break down of complex molecules and it releases energy when it does this.
After termination in transcription how does the process after differ in prokaryotes and eukaryotes?
-Prokaryotes after transcription go straight to translation allowing them to happen simultaneously.
-Eukaryotes undergo modifications after transcription.
How many amino acids would be in a peptide made from this transcript?
5' TTATGCCTAGGCGTAGTGGGTAGCCC 3'
3' AATACGGATCCGCATCACCCATCGGG 5'
6 amino acids
Summarize the three steps of transcription.
Initiation: RNA polymerase binds to promoter sequence, the DNA strands unwind, and RNA synthesis starts
Elongation: RNA synthesis occurs in the 5' to 3' direction.
Termination: RNA transcript is released and polymerase detaches from the DNA once termination sequence is found.
What are the names of the two individuals that hypothesized each gene encodes for a single enzyme.
Beadle and Tatum
What is the difference between competitive inhibition and non competitive inhibition?
Competitive: Inhibitor mimics substrate and competes for the active site.
Non-Competitive: Inhibitor binds to an allosteric site causing inactivation.