Biology
Name four cell organelles
Possible Answers: Nucleus, Mitochondria, Endoplasmic Reticulum, Golgi Apparatus, Ribosome, Lysosome, Chloroplast, Vacuole
How many percent of human body is water?
(a) 20%
(b) 30%
(c) 50%
(d) 60%
(d) 60%
How many valence electrons does carbon have?
4
What are the three macronutrients?
Carbohydrate, protein, fat
F=ma
Which organ produces insulin?
pancreas
What is the chemical formula for ammonium sulfide
(NH4)2S
How many kilocalories are in 175 grams of fat?
1575 kcal
Do heavier objects fall more slowly than lighter objects?
No. If an object is heavier the force of gravity is greater, but since it has greater mass the acceleration is the same, so it moves at the same speed
What is the start codon in DNA translation?
What is the path of the blood in the circulatory system of a mammal?
A) Vena cava, left atrium, left ventricle, pulmonary artery, lungs, pulmonary vein, right atrium, right ventricle, aorta, peripheral tissues.
B) Aorta, right atrium, right ventricle, pulmonary artery, lungs, pulmonary vein, left atrium, left ventricle, cava vein, peripheral tissues.
C) Vena cava, right atrium, right ventricle, pulmonary artery, lungs, pulmonary vein, left atrium, left ventricle, aorta, peripheral tissues.
D) Vena cava, right atrium, peripheral tissues, right ventricle, pulmonary artery, lungs, pulmonary vein, left atrium, left ventricle, aorta
C) Vena cava, right atrium, right ventricle, pulmonary artery, lungs, pulmonary vein, left atrium, left ventricle, aorta, peripheral tissues.
0.1 mol of hydrogen gas is placed in a closed container at 25°C, and the pressure in the container is 1 atm. What is the volume of the container?
2.44L
What is the function of cholesterol in a cell membrane?
a. Serves as an identifying structure to other cells using receptor mediated signaling
and specific cellular contact
b. Determines how rigid or flexible the lipid bilayer to provide adequate structural
support
c. Allows small substances to pass through the lipid bilayer during transport
b. Determines how rigid or flexible the lipid bilayer to provide adequate structural
support
Two identical cars collide head on. Each car is traveling at 100 km/h. The impact force on each car is the same as hitting a solid wall at:
(a) 50 km/h
(b) 100 km/h
(c) 150 km/h
(d) 200 km/h
(b) 100km/h
Since the collision is head on and each car is identical and traveling at the same speed, the force of impact experienced by each car is equal and opposite. This means that the impact is the same as hitting a solid wall at 100 km/h.
Which of the following transport processes requires energy (ATP or PMF):
A) Passage of water across a membrane by aquaporin
B) Insertion of a G-protein coupled receptor into the membrane
C) Passage of O2 gas from the chloroplast into the cytosol of a plant cell during photosynthesis
D) Uptake of sugars from the blood plasma into a muscle cell by a GLUT family transporter
B) Insertion of a G-protein coupled receptor into the membrane
Which of the following is TRUE about lipid digestion?
A) Bile salts activate pancreatic lipases and chymotrypsin, both required for lipid digestion
B) Pancreatic lipases digest lipids emulsified by bile salts synthesized in the gallbladder and stored in the liver
C) Lipases synthesized in the gallbladder digest lipids emulsified by bile salts synthesized in the pancreas
D) Pancreatic lipases digest lipids emulsified by bile salts synthesized in the liver and stored in the gallbladder
D) Pancreatic lipases digest lipids emulsified by bile salts synthesized in the liver and stored in the gallbladder
Cs+<Xe<Cs
What is the hormone that triggers hunger?
Ghrelin
What happens to the force of gravitational attraction between two small objects if the mass of each object is doubled and the distance between their centers is doubled?
The force stays the same
Below is the complete sequence of an mRNA that encodes a very short protein. What is the C-terminal amino acid of this protein?
GUACGACCAUGGCUGCUGUGUACGCAUCGAUGCGAUUGAGCUGAGAACGCGAAAAAA
Increased vascular tone in a segment of blood vessel:
A) Decreases radius of arteriole
B) Decreases resistance to blood flow
C) Builds up pressure in the downstream compartment
D) Increases blood flow to a peripheral tissue irrigated by this blood vessel
A) Decreases radius of arteriole
CaSiTe+CaTe2-->Ca2Si+SiTe4
8CaSiTe+2CaTe2-->5Ca2Si+3SiTe4
Which of the following functions of digestion systems does not happen in the large
intestine?
a) Chemical digestion through secretion of enzymes
b) Chemical digestion through bacterial actions.
c) Absorption of ions, water, and minerals.
a) Chemical digestion through secretion of enzymes
Two satellites are in circular orbit around the Earth. The distance from Satellite 1 to Earth’s center is r1, and the distance from Satellite 2 to the Earth’s center is r2, what is the speed of Satellite 2?
v1√r1r2