What is a translocation?
reciprocal interchange of parts on non-homologous chromosomes
What is the polarity of DNA?
5' to 3'
What causes the polarity of DNA?
The sugar phosphate backbone
What are homeologous chromosomes?
Chromosomes that are similar due to similar ancestral species, but not identical.
What is the C-value? What is a human's C value?
Amount of DNA in a haploid cell; humans C-value is 23 chromosomes
What do duplications lead to?
Evolution!
An organism has 100 basepairs in its genome. You find out 20% of its genome is Cytosine. What is the exact number of each nitrogenous base in its genome?
Cytosine: 20
Guanine: 20
Adenine: 30
Thymine: 30
What are the types of bonds that occur between Nitrogenous bases?
How many of these bonds are between each of the base pairs?
Hydrogen bonds
A/T has 2 bonds
C/G has 3 bonds
Define polyploidy and compare it to aneuploidy
Multiple copies of basic sets of chromosomes while aneuploidy is an abnormal number of chromosomes
How are aneuploidy cells often made?
A result of non-disjunction
On the board, draw an example of a Paracentric inversion
What are the classes and names of the nitrogenous bases?
Purines: Adenosine and Guanine
Pyrimidines: Thymine, Cytosine, and Uracil
Explain the differences between DNA and RNA
1. RNA is single stranded; DNA is double-stranded
2. RNA uses ribose sugar - extra OH on the 2' carbon
3. RNA uses Uracil base
Autopolyploid vs Allopolyploid?
Autopolyploids come from the same species
Allopolyploids come from multiple species
Endoreduplication: doubling of chromosomes when cell division is disrupted
Deletions are non-reversible. Why?
The DNA that is taken out of the chromosome is degraded and can't be rebuild without a template.
What is the name of the bond that connects the sugar to the base?
Glycosidic bond; a strong covalent bond
Draw the other side of the DNA strand:
5' ATGCGCTATGCATTCAGTCG 3'
3' TACGCGATACGTAAGTCAGC 5'
You are studying an invasive plant species that has 416 chromosomes. After studying some karyotypes, you believe there are 52 chromosomes per set. How many sets of Chromosomes does this plant have? How many chromosomes would be in a gamete?
8 sets of chromosomes
208 chromosomes in a gamete
What is the Transforming Principle experiment and who performed it?
Frederick Griffith; experiment on mice using Streptococcus pneumoniae. Found that there was a "transforming principle" that was moved from heat killed S strains into non-virulent R strains to make them virulent.
What are the two types of inversions that can take place?
Paracentric & Pericentric
Who created the DNA Double-helix model and whose pictures of DNA did they use to solve it?
James Watson and Francis Crick; Rosalind Franklin
Explain the Hershey and Chase experiment and how that changed what we view as the genetic material?
Experiment: radioactively labeled proteins and DNA in Bacteriophages. Let them inject genetic material into bacteria, then blended them and centrifuged them. Found that radioactively labeled DNA was the only part that made it into bacterial cells.
Therefore DNA, not proteins, was the genetic material that got passed down through generations.
Find the following Monoploid and Haploid numbers:
4N = 40
5N = 80
8N= 96
10, 20
12, 40
12, 48
Who was the first person to assign a specific gene to a chromosome?
Thomas Hunt Morgan