Which way does RNA polymerase read DNA?
From 3' to 5'
What does the mediator complex do?
The mediator complex recruits RNA polymerase complex to promoter.
What is one difference between translation in prokaryotes and eukaryotes?
What does CFPS stand for?
What is the difference between the structure of Uracil and Thymine?

Uracil Thymine
How many sub-sets are there in the process of transcription? Please list the names of each sub-set.
There are 5 sub-steps. Pre-initiation, initiation, promoter clearance, elongation and termination.
What is a "mature or "final" RNA transcript?
A "mature or "final" RNA transcript is a RNA molecule that has been processed and is ready to be exported from nucleus.
Provide a short definition of what cell-free protein synthesis is.
Cell-free protein synthesis is the production of proteins in a cell-free system using biological machinery.
Explain what the wobble effect is.
The wobble effect is when a single tRNA can bind to multiple codons. The non-standard base pairing for the 3rd base allows a single tRNA to bind to multiple codons.
Explain the role of RNA Polymerase.
RNA Polymerase separates DNA strands synthesizes RNA polymers and polymerization occurs in 5'-3' direction. The resulting product is a single stranded molecule.
Explain the role of DNA Polymerase.
DNA polymerase is used in DNA replication and synthesizes DNA polymers. Polymerization occurs in the direction of 5'-3' and results in a double-stranded molecule. In addition, DNA Helicase is required to unwind & separate DNA strands.
List five components used in CFPS. Provide specific examples for one of the components.
Some common components in CFPS are DNA, cell extract, amino acids, cofactors and an energy source. Some examples of cell extract would be E. coli, insect cells, yeast and wheat germ. They are commercially available.
What causes the base stacking interactions between bases in the DNA strand.
The hydrophobic effect causes the interactions between bases. Purine and pyrimidine bases are hydrophobic. Some stacking interactions are ID-ID and ID-PD. This also helps the DNA strands in a double helix to become more stabilized.
Transcribe the following strand but first determine the template strand.
3'-GGCTT[TGCCTTATAGC]GTA[T]ATAGTTTGAGTACTGCCTATATATATCAAT[TC]-5'
5'-CCGAA[ACGGAATATCG]CAT[A]TATCAAACTCATGACGGATATATATAGTTA[AG]-3'
Promoter +1 Site Terminator
Template strand is the top strand.
Transcribed strand: 5'- AUAUCAAACUCAUGACGGAUAUAUAUAGUUUUG- 3'
Transcribe the following mRNA strand using a codon table:
5'- AUAUCAAACUCAUGACGGAUAUAUAUAGUAAG- 3'
Met-Thr-Asp-Ile-Tyr-Ser-Stop
State two reasons why CFPS is better than other in vivo forms of protein synthesis.
The time it takes to complete the cell-free reaction is significantly shorter than in vivo. CFPS takes 1-2 days and in vivo typically takes about 1-2 weeks. Due to the fact that CFPS is an open reaction allows for the reaction to be closely monitored and manipulated according to desire. Non-standard peptides arise for this reason and has helped greatly in fields of chemical biology and therapeutics.