How many DNA molecules result at the end of DNA replication?
¿Cuántas moléculas de ADN resultan al final de la replicación del ADN?
2 identical DNA molecules
True or False: RNA is “double stranded” and DNA is “single stranded”
Cierto o Falso: El ARN es de "doble cadena" y el ADN de "cadena simple".
FALSE
Where does transcription occur?
¿Dónde ocurre la transcripción?
Nucleus
How does a deletion mutation affect the DNA?
¿Cómo afecta al ADN una mutación de "deletion"?
Nitrogenous bases are deleted.
What are the 3 parts of a nucleotide?
¿Cuáles son las 3 partes de un nucleótido?
1. Phosphate
2. Deoxyribose sugar
3. Nitrogen base
Why does DNA replicate?
¿Por qué se replica el ADN?
Growth and Repair
What are the four nitrogen bases?
¿Cuáles son las cuatro bases nitrogenadas?
Adenine, Guanine, Thymine , Cytosine
Where does translation occur?
¿Dónde ocurre la traducción?
Ribosomes (Cytoplasm)
What type of mutation is shown?
¿Qué tipo de mutación se muestra?
Insertion
True or False: Protein Synthesis consists of 2 steps, with translation coming first and transcription following.
Cierto o Falso: La síntesis de proteínas consiste en dos pasos: primero la traducción y después la transcripción.
FALSE
DNA replication occurs during what phase of the cell cycle?
¿En qué fase del ciclo celular ocurre la replicación del ADN?
"S" phase
What are the sugars called that found in RNA and DNA?
¿Cómo se llaman los diferentes azúcares que se encuentran en el ARN y el ADN?
DNA: Deoxyribose
RNA: Ribose
What is the biological process that makes proteins from mRNA?
¿Cuál es el proceso biológico que produce proteínas a partir del ARNm?
Translation
What type of mutation is illustrated?
¿Qué tipo de mutación se ilustra?
Substitution
How many codons are in the following DNA strand:
¿Cuántos codons hay en la siguiente cadena de ADN?:
ATCGCAGTCGTAGCATCGCGATCGTAGTCG
10 codons
What enzyme separates the nitrogen bases in the original DNA strand?
¿Qué enzima separa las bases nitrogenadas de la cadena de ADN original?
Helicase
DNA or RNA?
ATGTTAGCGTAGCT
DNA
TACAATCGCATCGA
Is this transcription or translation?
Transcription
True or False: SOMATIC cells are body cells that will NOT be passed down to offspring.
Cierto o Falso: Las células somáticas son células del cuerpo que NO pasarán a la descendencia.
TRUE
What part of DNA is the same for ALL living organisms?
¿Qué parte del ADN es la misma para todos los organismos vivos?
Nitrogen Bases
What the 3rd step of DNA replication?
¿Cuál es el tercer paso de la replicación del ADN?
DNA polymerase adds nucleotides to create the complementary strand. A=T, C=G
La ADN polimerasa agrega nucleótidos para crear la cadena complementaria. A=T, C=G
Give the correct complementary DNA strand to the DNA Template below:
Asigna la cadena de ADN complementaria correcta al molde de ADN que aparece a continuación:
ATTGGCATCATCGATGCTAGCTAC
TAACCGTAGTAGCTACGATCGATG
What amino acid is coded for DNA:TAC?
¿Qué aminoácido codifica el ADN:TAC?
MET
Would a mutation in the lung and brain cells affect the organism offspring? why or why not?
¿Una mutación en las células del pulmón y del cerebro afectaría a la descendencia del organismo? ¿por qué sí o por qué no?
No because the lung and brain cells are body cells. Sperm and egg cells would have to be affected in order to affect the organisms offspring.
No, porque las células del pulmón y del cerebro son células del cuerpo. Los espermatozoides y los óvulos tendrían que verse afectados para afectar a la descendencia del organismo.
After being diagnosed with cancer, Valeria found out the cells being affected are Gametes. Would this affect her offspring?
Tras ser diagnosticada de cáncer, Valeria descubrió que las células afectadas son gametos. Afectaría esto a su descendencia?
Yes, gametes affect the sperm and egg cells therefore this would be passed down to her offspring.
Sí, los gametos afectan a los espermatozoides y a los óvulos, por lo que esto pasaría a su descendencia.