DNA/RNA Structure
Where is DNA found? Where is RNA found?
DNA is found in the nucleus and RNA is found in the nucleus and the cytoplasm.
DNA->RNA->???->trait
What is missing?
Protein
What is a frameshift mutation?
When there is an extra inserted base in a DNA strand.
Do all cells have the same DNA?
YES
What is the corresponding RNA strand for this example?
ATGCATGCCCTA
UACGUACGGGAU
How many strands does DNA have? How many does RNA have?
DNA is double stranded (double helix), and RNA is single stranded.
What are the pairs of bases for transcription?
A-U, C-G
What is a point mutation?
When the bases are mismatched, for example A-G or T-C, which is incorrect.
What makes cells different?
Some genes are turned on and some are not.
What does AUG stand for on the codon chart?
Meth or start
What is the corresponding DNA pair for ATACCGGGTAT?
TATGGCCCATA
What does a translation translate?
mRNA->protein (amino acids)
What causes mutations?
Mutations are caused by UV light, disease, radiation, lifestyle, etc,.
What is the example Ms. Morse gave you about cell specialization?
A whole floor of a building gets electricity but if one room turns the lights of there is still electricity that goes to the rest of the floor.
What does UGA stand for on the codon chart?
Stop
What is the corresponding RNA strand for the following DNA strand, TAGCGTTAAGC?
AUCGCAAUUCG
Do translations use a codon chart?
yes
Is this an example of frame shift or point mutation?
ATTGCCTATCAGGATTTTGC
frameshift, there are two extra bases in the DNA strand
What are stem cells?
Cells that have most or all genes turned on.
What do A,T,C,G stand for?
A- adenine
T- thymine
C- cytosine
G- guanine
What does each type of RNA do?
mRNA gets information to the ribosome, tRNA gets amino acids to the ribosme, and rRNA is the ribosome.
What is protein synthesis?
When cells build specific proteins.
Is this an example of frameshift or point mutation?
CATGAC
TTACTA
point, because some of the bases do not match up correctly.
Do adult stem cells have differentiation?
Yes
Uracil