How Many People Didn't Know
These pairings of nitrogen bases always occurs
AT and CG
DNA Fingerprinting is also known as
DNA Profiling
Complete the following base pairing:
ATCCGATG
TAGGCTAC
An organic molecule that contains a unique genetic code withing the sequences of its nitrogen bases for each living organism
DNA
What percentage of our DNA makes us different from all other humans?
0.1%
If 30% of a DNA sample is amde up of cytosine (C), what percentage of the sample is made up of adenine (A)?
20%
This examines two samples that have the same band pattern linked to the same person in order to identify a suspect
Tissue Matching
Each band in a child’s DNA fingerprint must be present in at least one parent
Inheritance matching
Chromosome
An enzyme produced mainly by certain bacteria, having the property of cutting DNA molecules at or near a specific sequence of bases.
Restriction Enzyme
A laboratory method used to separate mixtures of DNA, RNA, or proteins according to molecular size.
Gel Electrophoresis
Put the following in order from smallest to largest:
Chromosome, Nucleus, Gene
Gene, Chromosome, Nucleus
A sequence of nitrogen bases within DNA molecule that code for a particular protein
Gene
When Gel Electrophoresis testing occurs, the ____________ fragments of DNA travel the fastest
Smallest
Shorter repeats of DNA sequences makes this type of testing easier to record
Short Tandem Repeats (STR)
A characteristic (structure or function) that an organism exhibits as a result of the genetic code within its DNA
Trait
A twisted ladder-like structure with a backbone of sugar and phosphate and internal rungs made of complimentary nitrogen bases
Double Helix
How does Gel Electrophoresis pull the DNA in order to show its bands?
DNA is negatively charged, DNA is pulled towards a positive charge
Given the following sample, how many pieces of DNA are present as a result of cutting?
ATCACCGGATCCGGTTAATACCGGCGATT
4
Non-coded DNA that contain unique patterns of repeated base sequences that are unique to individuals
Polymorphism
Four molecules that provide the codes for amino acids and ultimately, proteins within living organisms.
Nitrogen Bases