What does the prefix bio mean?
Life
Of what descent are Mongoloid bones.
Asian descent.
What does the nitrogen containing base adenine pair up with?
Thymine
Name a bone on your appendicular skeleton.
Arms, legs, shoulder and pelvic girdle
True or False. The smallest pieces of DNA move the fastest and the farthest away in a gel electrophoresis tray.
True
What does the suffix metrics mean?
Measurement
Name a bone that you can use to measure height.
Any long bone. Arms, legs.
What are the special enzymes that cut DNA called?
restriction enzymes
How many thoracic vertebrae do you have?
12
What region of your body is the axillary region?
Armpit
Name a common way that biometrics are being used in some industries today.
Hand scanner, eye scanners, vein geometry, facial recognition software
What is the difference between the male temporal bone and the female temporal bone?
Males temporal bone extends down past the ear.
What are the three parts of a DNA nucleotide?
Sugar-deoxyribose
Phosphate group
Nitrogen containing base
Atlas, axis
What is another name for you cheekbone?
Zygomatic process
What are the two traits that biometrics uses to obtain information?
Physical and behavioral traits
Name four things that we can tell about an individual based on their bones?
Age, gender, height, race
ATCCGGTCAGTAACCGGATA
When we cut using the restriction enzyme Haelll. How many pieces of DNA segments do we have?
3
Name the two bones in your lower leg and the two bones in your lower arm.
leg-tibia, fibula
arm-radius, ulna
What health career professional handles human remains, cleans skeletal remains and inspects decomposed remains for signs of trauma.
Forensic Anthropologist
Name two of the three components that all biometrics must have to function.
Sensor, computer, software
Name the 5 parts of your vertebral column, starting from the top to the bottom.
cervical, thoracic, lumbar, sacral, and coccyx)
ATCCGGTCAGTAACCGGATA
How many base pairs do we have in the first cut segment of DNA and how many pieces of DNA do we have in the last cut segment of DNA.
First 4
Last-5
Name 5 bones you would find in your face and explain where they are.
Fontal, parietal, temporal, occipital, maxilla, mandible, zygomatic process.
Name a behavioral trait used in biometrics?
Voice, handwriting, typing rhythm, gait analysis