What are plasmids?
Small circular DNA molecules used in cloning.
What is Taq polymerase?
This enzyme copies DNA during PCR.
What LIC stands for?
Ligation Independent Cloning
What is the enzyme that hydrolyzes starch?
What is a thermocycler?
This equipment heats and cools samples during PCR.
What is a restriction enzyme?
An endonuclease used to linearize the plasmid.
What is the melting temperature (Tm) of the sequence below?
AGGTCTAGGCTTAAGCG
A/T - 8
C/G - 9
Tm= (A/T x 2) + (C/G x 4)
Tm= 8x2 +9x4
Tm=52 0C
Why we have to transform BL21 cells?
Because the have the T7 RNA polymerase.
What is starch?
Is a plant-based polymer of glucose.
True or false: I should wear gloves all the time during a lab class.
TRUE!
Why do we have to do a plasmid clean-up after digesting the plasmid?
To remove the restriction enzyme from the solution.
What is the annealing temperature of a primer that the Tm is 63 degrees Celsius?
58 degrees Celsius.
Why E. coli cells carrying the sacB gene don't grow in the presence of sucrose?
Because they convert sucrose into levansucrose, which is toxic to the cells.
What is the metal molecule most used to bind to the his-tag?
Nickel.
What is a critical step while loading a centrifuge with tubes?
Balancing the centrifuge placing tubes across from each other or adding a tube with same volume of liquid if the number of tubes is odd.
I am using the plasmid p15TV-L to clone the mcbA gene. After transforming the DH5a cells, I could only see grown in the plate without sucrose. Why?
Because the sacB gene was not removed.
To confirm the gene insertion in the right location.
What to do if we want to have a gene inserted into a plasmid in only one possible orientation?
Use 2 different restriction enzymes.
Why do we have to add IPTG to the LB media when growing the BL21 cells?
To remove the Lac operator inhibitor from the Lac operator and allow the T7 RNA polymerase to work.
You accidentally vortex your plasmid sample too hard after miniprep. What might happen?
Shearing or degradation of the plasmid DNA.
I am digesting a plasmid with 2 restriction enzymes. One of them has 2 binding sites in the plasmid. How many band in an agarose gel will I see if I run my sample in a gel after digesting the plasmid?
3 bands.
Design the forward and reverse primers for the following sequence? 18 nucleotides long each.
GCGGCTGCGAGTGCTGAAACGGCGAACAAATCGAATGAGCTTACAGCACCGTCGATCAAAAGCGGAACCATTCT
Fw: GCGGCTGCGAGTGCTGAA
Rv: AGAATGGTTCCGCTTTTG
What does it mean if the DH5a cells only grow without sucrose?
It means that the sacB gene was not removed from the plasmid.
Why not using lactose instead of IPTG to induce protein expression?
Because IPTG is not metabolized by the cells.
A student’s DNA sample shows an A260/A280 ratio of 1.2. What does this indicate?
Indicates that there is too much protein contamination in the DNA solution