Ecology & Ecosystems
Define the terms "biotic" and "abiotic."
Biotic = living; Abiotic = nonliving
What process removes carbon dioxide from the atmosphere and converts it into organic material?
Photosynthesis.
Name the organelle where photosynthesis occurs and the organelle where aerobic respiration occurs.
Chloroplast = photosynthesis; Mitochondria = aerobic respiration.
What four nitrogenous bases are found in DNA? Which base replaces thymine in RNA?
DNA bases: G, C, A, T. In RNA, U (uracil) replaces T (thymine).
Define independent variable and dependent variable in an experiment.
IV = factor changed by experimenter; DV = measured outcome that depends on IV
What is the correct order (smallest to largest) for: species, population, community, ecosystem, biosphere?
Species → Population → Community → Ecosystem → Biosphere.
In an energy pyramid, approximately what percentage of energy is transferred from one trophic level to the next?
About 10%10%.
What are the three main parts (phases) of interphase and one major event that happens in each?
G1 (cell growth & protein synthesis), S (DNA replication), G2 (preparation for mitosis; more growth, organelles replicate).
Define a point mutation and a frameshift mutation.
Point mutation: single nucleotide change. Frameshift: insertion or deletion shifts reading frame.
In Maggie’s plant experiment (vinegar in one pot), identify the IV, DV, control, and two constants.
IV: addition of vinegar (acid) to one plant’s water. DV: plant growth (height/biomass). Control: the plant receiving no vinegar (normal water). Constants: same sunlight, temperature, water amount, potting soil, plant initial size/location.
Name two density-dependent limiting factors and one density-independent limiting factor.
Density-dependent: competition, predation, disease; Density-independent: unusual weather/natural disasters.
List two greenhouse gases named in the review and state one human activity that increases atmospheric CO2
Examples: CO2CO2 and CH4CH4 (also H2O vapor, CFCs, O3); human activity: burning fossil fuels/deforestation increases CO2CO2
Identify the stages of mitosis in order using the mnemonic PMAT and briefly state what happens in anaphase.
PMAT: Prophase (chromosomes condense, spindle forms), Metaphase (chromosomes line up at equator), Anaphase (sister chromatids separate toward poles), Telophase (nuclear envelopes reform). Anaphase: sister chromatids split and move to opposite poles.
What is nondisjunction and name one disorder that can result from it.
Nondisjunction = failure of chromosomes to separate during anaphase; can cause Down syndrome (Trisomy 21)
Describe the difference between exponential growth and logistic growth and sketch (verbally) the shape of each curve.
Exponential growth: population increases faster as it grows → J-shaped curve. Logistic growth: growth slows and levels off near carrying capacity → S-shaped curve.
Explain primary succession and give two examples of pioneer species.
rimary succession: begins on bare rock with no soil; Pioneer species include mosses and lichens (also ferns/grass).
Outline the main steps (phases/paths) of the carbon cycle including one process that buries carbon and one that releases carbon by burning.
Photosynthesis (removes carbon), respiration (releases carbon), exchange (dissolved/atmospheric CO2), sedimentation (calcium carbonate sediments), burial (fossil fuel formation), extraction & combustion (release carbon), decomposition (releases carbon).
Explain the difference between mitosis and meiosis in terms of number of divisions and the chromosome number of daughter cells (use 2n and n notation).
Mitosis: 1 division → 2 daughter cells, diploid 2n2n identical to parent. Meiosis: 2 divisions → 4 haploid nn cells (gametes), genetically distinct.
Describe the overall flow of information from DNA to protein naming both steps and where each occurs in the cell.
DNA → (transcription in nucleus) → mRNA → (translation at ribosome) → protein (amino acid chain).
Given a population graph that levels off near a value, what term describes this maximum sustainable population and what causes populations to reach it?
Carrying capacity; caused by limiting factors like food, water, space, shelter, disease, predation.
Describe how invasive species can reduce biodiversity and give one real-world example mentioned in the review text.
Invasive species outcompete natives (no predators/competitors) reducing native populations and biodiversity; example: Kudzu.
Explain bioaccumulation and give an example of a toxin and an affected organism type from the review.
Bioaccumulation = toxins build up in higher trophic levels; example: DDT accumulation in birds of prey.
Given the DNA strand TACGGCCGTAGTACT, write the complementary DNA strand, the mRNA transcribed from the original strand, and name which process each answer corresponds to (replication, transcription, translation).
Complementary DNA to TACGGCCGTAGTACT is ATGCCGGCATCATGAATGCCGGCATCATGA (pairing A–T, T–A, C–G, G–C). mRNA transcribed from original DNA (original given as template): replace T with U → AUGCCG GCA UCA UGAAUGCCG GCA UCA UGA (teacher: check spacing/codon parsing). Processes: complementary DNA = replication; mRNA = transcription; amino acids from mRNA = translation.
A DNA strand is shown as AGC CAT GTA TAC. Provide the complementary DNA strand and explain why your answer is correct.
Complementary to AGC CAT GTA TAC is TCG GTA CAT ATGTCG GTA CAT ATG (A↔T, G↔C). This follows base-pairing rules.
A bromthymol blue experiment turns from yellow back to blue when an aquatic plant is placed in sunlight. Explain why this happened using the processes involved (use CO2 and O2 in your explanation).
In sunlight, the plant performed photosynthesis, which used CO2CO2 (removing it from the solution) and produced O2O2; removal of CO2CO2 shifted the bromthymol blue back to blue because it is less acidic when CO2CO2 is removed.