PCR
What is PCR?
- A polymerase chain reaction is used to view diseases, clone, and sequence genes
- rapidly replicates base sequences of DNA
What is Agarose?
Made from seaweed; a porous like substance in which the DNA will travel through
Which is the enzyme responsible for transcription and the region in which it attatches?
RNA polymerase + promoter
Where does translation take place?
In the CYTOPLASM
How would you know the difference between DNA and RNA sequences?
The T in DNA is replaced by U in RNA sequence
Base pairing rules for RNA: A & U, C & G
Why is TAQ Polymerase used in PCR? Where is it found?
1. TAQ Polymerase is heat resistant and able to withstand high temperatures needed for PCR
2. Bacteria is found in hot springs! (Yellowstone)
True or False? Larger fragmented molecules move faster in the polysaccharide network of the agarose gel?
False: Larger fragmented molecules move slower while smaller fragments move faster
True or False: mRNA leaves the nucleus after being processed
TRUEEEEEEE, EXITS THE NUCLEUS TO A RIBOSOME
True or False: tRNA does not carry an amino acid to the RNA molecule
FALSE: it does carry an amino acid that matches the codon (set of 3 nucleotides that encodes for one amino acid) tRNA molecules bring the amino acids to the ribosome and tRNAs adapt to recognize the genetic code
Name the 3 parts of a nucleotide
1. Phosphate group
2. Sugar
3. 1 out of 4 nitrogenous bases
Name the 3 steps of PCR and the function
Denaturation →In terms of DNA, use heat to break down those hydrogen bonds between the two strands and separate them
Annealing →primers are attached to the beginning and the end of the DNA strand
Extension →TAQ Polymerase starts to make copies
If DNA is negatively charged, where will the DNA molecules migrate in the Gel Electrophoresis apparatus?
What are introns and exons? What else must take place before mRNA can leave the nucleus?
- Introns: Noncoding segments of RNA are removed
- Exons: The parts of a gene that are expressed are spliced together
- A cap and tail are added to the mRNA strand
Define mRNA, tRNA, and rRNA and their purposes
2. Messenger RNA (mRNA) and its purpose
- Carries the information that specifies a protein. It is a copy of the information stored in DNA.
2. Transfer RNA (tRNA) and its purpose
- Molecules that are connectors that carry each amino acid to the correct spot along the mRNA molecule
3. Ribsomal RNA (rRNA) and its purpose
- Is part of the ribosome, the physical location where translation occurs
Restriction Enzymes and their purpose?
Restriction enzymes look for a specific sequence to cut DNA into fragments
What is a centrifuge's purpose and function
Uses centrifugal force to separate substances suspended in liquid or solid material according to particle size and density differences.
Which breast cancer gene was being observed during the gel electrophoresis lab?
BRCA2 gene
What are the 3 steps of Transcription and define them.
Intiation:
Binding of the enzyme to the promoter area of the gene
Opening of the double helix - to read one of the strands
Elongation:
Termination:
What would be the corresponding amino acids for the mRNA sequence?
UGGGUAUGUCACGAUAGGCA
AUG: START CODON MET
UCA: SER
CGA: ARG
UAG: STOP CODON
Why did we have to place our cheek cells in a solution of NaCl?
Damage the cell and nuclear membrane to get to the DNA and dissociate the negatively charged DNA molecules with the Na+ & Cl- ions
What are 4 components needed for a PCR reaction?
DNA sample
Primer (indicate beginning and end of section to copy
dnTPS →nucleotides
TAQ polymerase → enzyme (protein) that reads the base sequence and brings forth the corresponding nucleotides → withstands high temperatures
What mode of inheritance is breast cancer and what does it mean in relations to breast cancer?
Autosomal Dominant --> only one mutated allele is needed to increase chances of developing breast cancer
For this DNA sequence, code the complementary mRNA sequence:
AGCTTAGACTATTGCGCCTG
UCG AAU CUG AUA ACG CGG AC
Translation has the same three steps as transcription (initiation, elongation, termination), elaborate on all three steps.
Initiation: mRNA is the template and binds to the small ribosomal subunit, then the initiator tRNA molecule binds to mRNA. The anti-codon matches up with the first mRNA codon then the large subunit binds to the small subunit to complete the initiation. At the end of the initiation stage, the ribosome creates a ring around the beginning codons of the template “mRNA.
Elongation: tRNA matches up amino acids to mRNA, amino acids are joined together with a peptide bond. The ribosome moves to the next codon and the chain held by peptide bonds is further lengthened. The next tRNA enters the ribosome next to the initiator tRNA. It’s anticodon base pairs with the next mRNA codon (aa positioned directly next to each other). At each mRNA codon, the elongation process repeats.
Termination: The ribosome reaches the stop codon, which is at the end of the mRNA. A protein called the release factor binds to the stop codon. There is no tRNA that combines there, so no more amino acids will be added. The mRNA ribosome unit structure disassembles; the chain of amino acids is released from the ribsomes and folds into a functional protein.
According to the Hardy-Weinberg equation -- If 11% of people in Ireland have red hair:
1. What is the frequency of the non-red hair allele?
2. What percentage of this population is heterozygous for red hair?
11% population red hair --> q2 = .11
1. Frequence of non-red hair allele
- q= Sqroot (.11) = .33
- p = 1 - .33 = .67
2. % of population is heterozygous for red hair
- 2 x .67 x .33 = .4422 →44.22%