translation
the end of an amino acid that can accept another amino acid
what is the C terminus
tool for intron removal
what are snRNPs
the goal of meiosis
to make daughter cells with exactly half as many chromosomes as the starting cell with genetic diversity
What is the difference between intracellular signaling and intercellular signaling?
Intracellular signaling occurs within a cell, and intercellular signaling occurs between cells.
what is the ration of phenotypes for a dihybrid cross for two heterozygous individuals
9:3:3:1
the three parts of the ribosome
what are E(exit),P(peptidyl),A(Acyl)
which mRNA is bigger, the premature mRNA or the processed mRNA
what is premature mRNA
The part of meiosis that is similar to mitosis is ________.
what is Meiosis II
The secretion of hormones by the pituitary gland is an example of
what is endocrine signaling
Hemophilia is an X-linked recessive condition in which blood does not clot properly. Queen Victoria of England had one allele for hemophilia. Most of her male descendants had the disorder, but few females had it.
Why did hemophilia occur more frequently in Queen Victoria’s male descendants
Only one copy of the X chromosome is found in cells of males, but two copies are found in cells of females.
A frameshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one nucleotide. Why?
what is, If three nucleotides are added, one additional amino acid will be incorporated into the protein chain, but the reading frame wont’ shift.
these are added to the ends of mRNA before it can leave the nucleus to be translated
what are a 5' cap and a poly a tail
If a muscle cell of a typical organism has 32 chromosomes, how many chromosomes will be in a gamete of that same organism?
What is 16
what messengers diffuse fast, and so work very quickly to activate other molecules
what are second messengers
Mendel performs a cross using a true-breeding pea plant with round, yellow seeds and a true-breeding pea plant with green, wrinkled seeds. What is the probability that offspring will have green, round seeds? Calculate the probability for the F1 and F2 generations.
3/16
A scientist sequencing mRNA identifies the following strand: 5’ CUAUGUGUCGUAACAGCCGAUGACCCG 3’ What is the sequence of the amino acid chain this mRNA makes when it is translated?
What is, Met Cys Arg Asn Ser Arg
Non-template 5' AGTCCAGGACCTTACGGAT 3' Template 3' TCAGGTCCTGGAATGCCTA 5'
what would the RNA look like?
5' AGUCCAGGACCUUACGGAU 3'
happens if someone has down syndrome
what is trisomy 21 (a genetic condition caused by an extra chromosome)
Endocrine signals are transmitted more slowly than paracrine signals because
what is because ligands are transported through the bloodstream and travel greater distances
In pea plants, purple flowers (P) are dominant to white flowers (p) and yellow peas (Y) are dominant to green peas (y). What are the possible genotypes and phenotypes for a cross between PpYY and ppYy pea plants? How many squares do you need to do a Punnett square analysis of this cross?
PpYY, PpYy, ppYY, and ppYy
The former two genotypes would result in plants with purple flowers and yellow peas, while the latter two genotypes would result in plants with white flowers with yellow peas, for a 1:1 ratio of each phenotype
A normal mRNA that reads 5’ –AUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ –AUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Original mRNA: 5’ – AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’ Translation: Met – Val – Ile – Thr – His – Glu – Ala Mutated mRNA: 5’ – AUG GUU AAU AAC ACA UGA GGCCUGAAC– 3’ Translation: Met – Val – Asn – Asn – Thr
Transcribe the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
The mRNA would be: 5'-AUGGCCGGUUAUUAAGCA-3'.
what are the checkpoints a cell has to go through before it can do mitosis
end of g1, end of g2, during metaphase
what number am i thinking of (1-10)
7
A large ear of corn has a total of 433 grains, including 271 Purple & starchy, 73 Purple & sweet, 63 Yellow & starchy, and 26 Yellow & sweet.
calculate chi square value
8.01