Scientific Method/Chr. of Life
Biochem
Cells
Cell Transport
DNA/RNA
100
Organisms exhibit this characteristic that tends to stabilize the effects of environmental change.
What is homeostasis
100
This biomacromolecule contains Carbon, Hydrogen, Oxygen, Nitrogen, and sometimes sulfur.
What is a protein
100
These cells have no internal membrane bound organelles
What is a prokaryote
100
The process of molecules moving from a high concentration to a low concentration through a protein channel.
What is facilitated diffusion
100
What is one difference between DNA and RNA (can't be based on the spelling)
What is deoxyribose vs. ribose, single vs. double strand...
200
A scientist observes honey bees going from one flower to another in his garden. What must he do before he conducts an experiment about the honey bees?
What is make a hypothesis
200
A single unit of a carbohydrate
What is a monosaccharide
200
A researcher made an interesting observation about a protein made by a ribosome on the Rough ER and eventually would find its way into the plasma membrane. The protein in the membrane is slightly different than the one made on the ER. How is this possible?
modified by the golgi bodies
200
A white blood cell eats an invading bacterium as a part of your immune system.
What is phagocytosis
200
If a single strand of DNA goes: ATCGGGCTTAGTTTAAGGCCTTGATTCGGTTTA How many hydrogen bonds would it form with its complimentary strand?
What is 80
300
This characteristic of life explains a plant leaning towards sunlight
What is respond to stimuli
300
These biomacromolecules make up the membranes of all cells
What is phospholipids
300
The Endoplasmic Reticulum is an organelle that looks like a ribbon because that increases _________ and reduces _________.
What is surface area...volume
300
For a plant cell to swell and maintain turgor pressure it must exist in what type of environment?
What is hypotonic
300
This is the stage where the template strand of DNA is read by a protein and strand of RNA is synthesized.
What is transcription
400
Tropical birds called oilbirds nest in caves and emerge at night to forage for seeds. A biologist thinks that oilbirds might be able to avoid obstacles in their caves by making sounds and listening to echoes. Describe a controlled experiment that the biologist could do to test her hypothesis.
multiple answers. must include control group, experimental group. only 1 variable.
400
Briefly explain why all starch molecules are pretty much the same, but there are millions of kinds of protein molecules.
Starch molecules are made up entirely of glucose, proteins are each made up of some combination of amino acids (of which there are 20)
400
three structures found in a plant cell and not in an animal cell
What is the large central vacuole, cell wall, chloroplast
400
A sodium pump is an example of...
What is active transport
400
The process that occurs using ribosomes to read mRNA and synthesize proteins
What is translation
500
Jason tried a new fertilizer called MegaGro™ on his garden. He said, "I used it on all my tomato plants this year, and they grew much better than they did last year! MegaGro™ is fantastic!" Was Jason's test of MegaGro™ scientifically valid? Why or why not?
no, no control group
500
Specific enzymes in your intestine enable you to break down starch and use the glucose molecules produced by this process. But you cannot break down cellulose. Explain why, in terms of both carbohydrate structure and protein shape.
lock and key model, alpha vs. beta linkage
500
Name all the parts of cell theory.
What is 1) all living things made of cells 2) cells are basic unit of structure and function 3) cells only come from preexisting cells
500
A cell is placed into a solution of 25% salt which causes it to shrink. How would you describe the cytosol in relation to the environment that the cell is in?
What is hypotonic
500
The significance of DNA replication occurring semi-conservatively.
What is a way for the cell to insure that DNA is replicated without error.