1
Twisted ladder shape
Double Helix
The synthesis of mRNA from DNA.
Transcription
The type of RNA that associates with proteins to form ribosomes in the cytoplasm.
rRNA
Technology that involves manipulation of the DNA of one organism in order to insert exogenous DNA (The DNA of another organism).
Genetic Engineering
Organisms that have been genetically engineered by inserting a gene from another organism
Transgenic Organisms
Parental strands of DNA separate, serve as templates, and produce DNA molecules that have one strand of parental DNA and one strand of new DNA.
Semiconservative replication
Long strands of RNA nucleotides that are formed complementary to one strand of DNA.
mRNA
Smaller segments of RNA nucleotides that transport amino acids to the ribosome.
tRNA
The total DNA present in the nucleus of each cell.
Genome
Involves separating the DNA fragments using gel Electrophoresis in order to observe the distinct banding patterns that are unique to every individual.
DNA Fingerprinting
An enzyme that catalyzes the addition of appropriate nucleotides to the new DNA strand.
DNA Polymerase
An enzyme that regulates RNA synthesis, binds to a specific section where an mRNA will be synthesized.
RNA Polymerase
A permanent change occurs in a cell’s in a cells DNA.
Mutation
Uses an electric current to separate DNA fragments according size.
Gel Electrophoresis
A field of study that involves creating and maintaining databases of biological information.
Bioinformatics
Small fragments synthesized discontinuously by the DNA polymerase in the 3’ to 5’ direction.
Okazaki Fragments
Where the code is read and translated to make a protein.
Translation
Substances that cause mutations.
Mutagen
Enzymes that cleave or cut the DNA within a certain sequence like GAATTC.
Restriction Enzyme
What is the RNA complement of the DNA sequence GTTAC
CAAUG
The phosphate groups in DNA create a negative charge, which attracts the DNA to the positively charged histone proteins.
Nucleosome
The three-base code in DNA or mRNA that codes for an amino acid.
Codon
The process by which desired traits of certain plants an animals are selected and passed on to their future generations.
Selective Breeding
A technique scientists use to make exact genetic copies of living things.
Cloning
WILD
First team to decode the sentence.
ATGATAGATCTGCTTCCGAGAAGCTAG