Sugar in DNA?
Deoxyribose
What is the name of the process of making RNA from DNA?
What is transcription?
Where does the latter portion of translation take place?
What is the ribosome?
True or false: There are 3 start codons.
False, there is one
What does DNA stand for?
Deoxyribonucleic acid
What nitrogenous base is found in RNA but NOT DNA?
What is uracil or U?
What enzyme reads DNA to synthesize RNA?
What is RNA polymerase?
What carries the amino acid to the ribosome during translation
tRNA
T/F: there are 3 stop codons
True
In a DNA strand, What do you call the section that tells RNA polymerase to stop.
The terminator region
How many nucleotides make up a codon?
What is 3?
Where does transcription occur?
What is the nucleus?
Transcribe this DNA:
CCG TAT
What is GGC AUA?
Anticodons are found on what?
tRNA
Promoter region.
What is the mRNA for this DNA sequence:
AAC GAT TTC
What is UUG CUA AAG?
What type of RNA is pictured here?

What is mRNA?
AUG is also known as...
a start codon
T/F: The ribosome is made up three subunits
False, it is made of 2 subunits (small and large)
In a DNA strand, there are 100 bases total, 21 are adenine, how many are guanine?
29 bases are guanine.
What type of RNA is made in the nucleus before being transferred to a ribosome?
What is mRNA?
Transcribe and Translate the following DNA sequence:
TTCATACATGCGCCACGACATC
Mrna: AUG-UAC-GCG-GUG-CUG-UAG
AA: MET/Start- Tyr-Ala-Val-Leu-Stop
How many nitrogen bases would code for 3 amino acids?
What is nine? (3 for each codon)
What amino acid starts off every polypeptide?
What is methionine?