DNA Structure & Function
What holds nitrogen bases together in DNA?
Hydrogen Bonds.
When in a cell's life cycle does DNA replication occur?
During the synthesis (S) stage of the cell cycle prior to cell division (mitosis)
During transcription, ______ is used as a template to synthesize ______.
DNA ; RNA
What's the definition of a mutation?
A change in a sequence of DNA.
Who is credited with discovering DNA's structure?
Watson & Crick
What are the base pairing rules in DNA?
A-T and C-G
DNA replication is known to be _______ because in each copy that is synthesized there is a new strand and an old strand.
Semiconservative.
What is the start codon and what amino acid does it code for?
AUG and it codes for methionine (Met)
What is a mutagen? What is an example?
DNA's structure is known as the _________.
Double Helix
What is the difference between a pyrimidine and a purine?
Pyrimidines have one ring in their structure while purines have two.
DNA Helicase and DNA Polymerase are the two ______ in charge of DNA replication.
Enzymes
Given the DNA sequence: TATTACGAGCACTATCAT
What will be the sequence of mRNA after transcription.
AUAAUGCUCGUCGUGAUAGUA
Translocation is a type of chromosomal mutation where ______ chromosomes cross over.
Nonhomoloous
Ribosomes form _______ between amino acids during the process of translation in cells.
Peptide bonds.
Name the three components of a nucleotide.
-Phosphate
-Sugar
-Nitrogen Base
List the steps of DNA Replication.
DNA Helicase breaks H-bonds which unzips the DNA strand. DNA Polymerase adds free-floating nucleotides to each original strand.
A ______ is a sequence of three nucleotides that codes for one amino acid.
codons are found within __________.
anticodons are found within________.
Codon
mRNA
tRNA
What's the difference between a point mutation and a frameshift mutation.
Point mutations are the substitution of one nucleotide out for another.
Frameshift mutations are the insertion or deletion of a nucleotide in a DNA sequence.
Write out the central dogma of biology.
DNA can go through Replication
DNA can be converted to mRNA during transcription
mRNA is then converted protein through translation
What are the four nitrogen bases in DNA?
Adenine, thymine, cytosine, and guanine.
Given the DNA sequence: ATCGATGGCATAG.
What will be the product after DNA replication is complete?
Two copies of: ATCGATGGCATAG
TAGCTACCGTATC
What are the three types of RNA and what are they each used for?
-Ribosomal RNA: forms part of ribosomes where proteins are made.
-Transfer RNA: brings amino acids from the cytoplasm a ribosome.
Will mutations in somatic cells affect potential offspring of the individual with the mutation? Why or why not?
Mutations in somatic cells will not affect potential offspring. Only mutations in gametes could have an effect on the offspring of an organism
List the differences between DNA and RNA.
DNA is double-stranded, uses deoxyribose as its sugar, and contains thymine.
RNA is single-stranded, uses ribose as its sugar and contains uracil (U).