DNA Structure
Watson and Crick used this term to describe the shape of DNA.
What is a double helix?
This is what results from copying one molecule of DNA.
What are 2 molecules of DNA?
A kind of virus that infects bacteria.
What is bacteriophage?
These 2 scientists drew the conclusion that DNA is the genetic material found in genes.
Who is Hershey and Chase?
Watson and Crick make their double helix model out of these 2 materials.
What is cardboard and wire?
The type of bond that holds bases together in the double helix.
What is a hydrogen bond?
This is the first step in the replication of one DNA molecule.
What is the unwinding (or separation) of DNA?
The process in which one strain of bacteria is changed by a gene or genes from another strain of bacteria.
What is transformation?
This scientist used S-strain (disease-causing bacteria) and R-strain (harmless bacteria) and tested how bacteria makes people sick using mice.
Who is Frederick Griffith?
Explain why it is important for hydrogen bonds to be strong enough and weak enough.
What is "the hydrogen bond needs to be strong enough to hold together but weak enough to be pulled apart?" (Critical to DNA's function)
The role of DNA in heredity.
What is DNA acts as a "blueprint" for future production of organisms?
This is what you call a "G" binding with a "C" or an "A" binding with a "T."
What is a base pair?
Describing when the DNA fibers are stretched in a thin, glass tube until parallel. Regular x-rays alone did not reveal the structure of DNA.
What is X-ray diffraction?
This scientist used x-ray diffraction to get information about the structure of the DNA molecule. She noticed that DNA was twisted like a helix.
Who is Rosalind Franklin?
3 roles of DNA.
What is storing info, copying info, transmitting info?
DNA is a nucleic acid made up of this.
What are nucleotides?
The new strand of DNA from this old strand:
AACGTACGGGTAACCCGGATA
What is:
TTGCATGCCCATTGGGCCTAT ?
The repetitive DNA at the end of the eukaryotic chromosome.
What is a telomere?
He is credited with the discovery that the amount of G's was equal to the amount of C's (and A's with T's) in several samples of DNA.
Who is Erwin Chargraff?
4 nitrogenous bases (by name).
What is Adenine, Thymine, Guanine, and Cytosine?
The enzyme that is used to make a copy of a DNA molecule.
What is DNA polymerase?
This is what DNA stands for.
What is Deoxyribonucleic acid?
This scientist added enzymes to destroy proteins, lipids, etc., but transformation still occurred. He then added enzymes to destroy DNA. He discovered that DNA was the transforming factor.
Who is Oswald Avery?
The double helix model focused on these 3 things.
What is antiparallel strands, hydrogen bonding, and base pairing?