Enzymes
Repairing Mistakes and DNA damage
What is a gene?
Structure of DNA
DNA Synthesis
100

What is primase?

synthesizes an RNA primer

100

What is the error rate during DNA replication

1 per billion deoxyribonucleotides

100

What is the definition of a gene?

a region of DNA that contains the regulatory sequences and coding information for the transcription of one or more related functional RNA molecules, some of which encode polypeptides

100

What is a deoxyribonucleotide made up of?

a phosphate group, a deoxyribose sugar, and a nitrogenous base

100

Which direction does DNA synthesis always follow?

5' --> 3'

200

What is helicase?

Opens the double helix

200

What is DNA polymerase proofreading? What is it's error rate?

When newly synthesized DNA doesn't have the same base paring, the mismatch will be placed into a exonuclease site and be removed. 

Error Rate: 1/100

200

What was the name of the experiment that determined what the genetic material was?

Hershey-Chase Experiment

200

What are the complementary base pairs? How are base pairs held together?

A-T, C-G; Hydrogen bonds

200

What is a SSBP and what is its function?

Single-strand DNA binding proteins; they stabilize single-stranded DNA

300

What is ligase?

joins Okazaki fragments together

300

What is DNA Polymerase fidelity? What is its error rate?

DNA Polymerase will only work if there is appropriate base pairing

Error rate: 1/100,000 base pairs

300

What was the DNA hypothesis?

Radioactive phosphorous would be found in the pellet, while radioactive sulfur would be found in the solution

300

How is DNA stabilized?

1) complementary base pairings

2) interactions between stacked base pairs inside the helix 

300

What would the new DNA sequence be if DNA polymerase were added to the bottom strand?

3'- ATGCCGAATGCAAGGCCATAAGTCC - 5'

            5' - ACGUUCC - 3'          

5' - GGTATTCAGG - 3'

400

What is DNA polymerase lll?

polymerizes (adds) deoxyribonucleotides 

- majority of our DNA synthesis

400

What is mismatch repair? How does it work? What is the error rate?

A type of DNA repair used to correct mismatched base pairs that result from mistakes in DNA synthesis

Mismatch repair proteins scanning DNA for a mismatch. When a mismatch is found, enzymes remove newly synthesized strands and replace them with a new and correct synthesized piece.

Error Rate: 1/100

400

What was the protein hypothesis?

Radioactive sulfur would be found in the pellet, while radioactive phosphorus would be found in the solution

400

What are the 2 major features of DNA?

1) backbone made up of sugar and phosphate groups

2) a series of bases that project from each sugar in the backbone

400

Explain the differences between leading stand synthesis and lagging strand synthesis.


Leading strand

- continuous, follows the replication fork


Lagging stand

- discontinuous (short fragments that are ultimately stitched together), moving away from the replication fork

500

What is DNA polymerase l?

removes RNA primer and replaces the ribonucleotides with deoxyribonucleotides

500

What is nucleotide excision repair?

What aspect of DNA structure make it possible for the proteins of the nucleotide excision repair to recognize many different types of DNA damage?

a type of DNA repair that removes a damaged region in one strand of DNA, and replaces it with the correct sequence using the undamaged stand template.

- works on DNA damage caused by UV light (180nm-380nm)

- nucleotide excision repair removes thymine dimers

- the regularity of DNA's overall structure

500

What did the Hershey-Chase experiment conclude?

DNA was the genetic material, not protein

500

How do you distinguish the two ends of a strand of DNA?

The distinct 5' and 3' ends. The 5' has the phosphate group and the 3' end has the hydroxyl (-OH)

500

Where does the energy for DNA replication come from?

Nucleotides start synthesis in their triphosphate form and cleaves off phosphates to release energy (hydrolysis reaction). This energy then makes the endergonic reaction exergonic and DNA synthesis will begin