The first step of DNA fingerprinting/profiling
DNA extraction
An organism with one or more genes from another species
Transgenic organism
A sequence of DNA that carries the coded instructions for building a polypeptide/protein.
What is a gene?
Transcribe the following DNA sequence:
ATGCATGGC
UACGUACCG

Translation takes place when the mRNA leaves the nucleus, goes into the cytoplasm and heads to a __________.
Ribosome
True/False: a mutation always changes a trait in the organism
False - a mutation is a change in the base-pair sequence and it may or may not cause a change in a trait
Makes millions to billions of copies of a specific DNA segment
Polymerase Chain Reaction (PCR)
A circular piece of DNA naturally found in bacteria, often used as a vector to deliver genes into host cells.
Plasmid
What is the backbone of the DNA strand made up of? (2 molecules)
deoxyribose sugar and phosphate
What are the two steps of Protein Synthesis called, IN ORDER.
Transcription, Translation

What is the monomer of a protein?
amino acid

What are substances or agents that cause mutations called?
Mutagens
Non-coding regions of DNA with repeats around 3-7 base pairs in length such as GATTACAGATTACAGATTACA
What are Short Tandem Repeats (STRs)?
In CRISPR gene editing, this molecule directs the editing machinery to a specific DNA sequence by matching its bases to the target.
The type of bond that holds bases together in the double helix.
Hydrogen Bonds
:max_bytes(150000):strip_icc()/GettyImages-680790233-5897f4fb5f9b5874eed4b5b2.jpg)
In translation the mRNA strand binds to the ribosome and brings in tRNA, what is being made?
polypeptide

During Transcription, what enzyme reads the DNA template strand and converts it to mRNA?
RNA Polymerase
When bases are inserted or deleted it causes a ___________. This causes all of the codons "downstream" to change, greatly changing the amino acid sequence in a protein.
frameshift
During gel electrophoresis, explain two factors that affect how and why DNA fragments move through the gel.
1. The charge of the DNA fragments - DNA is negatively charged so all fragments move toward the positive electrode
2. The size of the DNA fragments - smaller fragments move faster and therefore farther
In the CRISPR system, this enzyme acts as molecular scissors, cutting DNA at the location specified by the guide RNA.
What is Cas9?
What DNA is included in the genome of an animal cell?
Nuclear DNA
Mitochondrial DNA
In order to release the amino acid from tRNA, the ________ on the mRNA and the __________ on the tRNA must connect.
codons, anti-codons
What mRNA codon(s) would translate to Serine?
UCU
UCC
UCA
UCG
AGU
AGC
What is the only type of mutation that can be inherited?
Gametic mutation
5 applications of DNA Fingerprinting
1. Forensics
2. Paternity testing
3. Identify human remains
4. Identify genetically modified organisms
5. Determine evolutionary relationships among organisms
In reproductive cloning, the nucleus from a body (somatic) cell is transferred into an egg cell that has had its own nucleus removed in a process called____.
Somatic Cell Nuclear Transfer (SCNT)
A woman is suing a man for child support. The man claims the baby is not his. A paternity test is performed to compare the baby's DNA with the man's DNA. What would a positive test result look like?
The results of the DNA fingerprinting will show half the bands from the mother and half from the father.
If the man is the father, every band in the baby's DNA profile that does not match up with the mother's DNA bands must match the man's DNA bands.
What are these 3 types of RNA and what do they do?
A. rRNA: builds the structure of the ribosome and helps to form the peptide bonds that hold amino acids together.
B. tRNA: brings amino acids to the ribosome.
C. mRNA: brings the genetic information from the nucleus to the cytoplasm/ribosome
What are the 3 amino acids associated with the following DNA sequence?
TAC TGT AAA 
AUG: Met - Start
ACA: Thr
UUU: Phe
Describe what type of mutation results in:
1. Different base(s), same protein
2. Different base(s), different protein
3. Different base(s), non-functioning protein; early STOP codon
1. Silent
2. Missense
3. Nonsense