What is the base pair rule in DNA?
A to T, C to G
This particular process results in a mRNA strand and occurs in the nucleus. (Hint: it happens 1st)
Transcription
What kind of shape is a protein?
3 dimensional
Trade Request:
How many nucleotides result in a codon?
3
What is a gene?
a section of DNA that has instructions to code for a protein
What three nucleotides are found in both DNA and RNA?
A, G, C
Tax Man:
This particular process turns codons found on RNA into a polypeptide chain of amino acids. What is the name and where does it happen? (Hint: it happens 2nd)
Translation in the ribosome.
What makes proteins unique?
The way the protein is folded.
How many codons result in an amino acid?
1
What is the result of DNA replication?
Two identical strands of DNA that contain one original strand and one new strand.
Double Jeopardy:
What is the structure of a nucleotide?
A sugar, phosphate, and base
Why does DNA need RNA?
DNA can't leave the nucleus, therefore it needs RNA to communicate with the ribosome where proteins.
A protein is a strand of amino acids held together by what type of bond?
Polypeptide bonds
The codon UCA results in the creation of what amino acid?
Serine
What nitrogenous base is found in mRNA, but not DNA?
Mandatory Generosity:
Uracil
What is the name of the structure in DNA that is held together by strong covalent bonds?
Sugar phosphate backbone
Transcribe the following DNA sequence:
TTAGCGTAT
AAUCGCAUA
Trade Request:
What signal is given to indicate protein completion?
The STOP codon.
The mRNA sequence: AUGAAGUGC results in the amino acids Met-Asp-Cys.
Which amino acid is incorrect?
Asp
Describe anaerobic respiration, specifically in relation to energy production.
Anaerobic Respiration takes place in the mitochondria without oxygen resulting in far less ATP production, as compared to aerobic respiration.
What type of bond holds the bases together and why is it necessary?
Hydrogen bonds that are weak, because they need to unzip for replication.
Double Jeopardy:
Translate the following RNA sequence.
AAUCGCAUA
Asp-Arg-Iso
How does the DNA affect the resulting protein?
DNA codes for proteins and different sequences result in different amino acids, resulting in proteins with different shapes.
All or Nothing
TACCATCGATTGGAAGACCTTAACGAGCTAACT
The DNA sequence above results in what amino acids?
Met – Val - Ala – Asp – Leu – Leu – Glu. Acid – Leu – Leu – Asp. Acid - stop
Name monomers of each macromolecule and at least one example of a polymer for each.
Carbs-Monosaccharides (Starch,Glycogen)
Lipids-Fatty Acids and Glycerol (Fats, Oils, and Waxes)
Protein-Amino Acids (Enzymes, Insulin, Hemoglobin)
Nucleic Acids-Nucleotides (DNA and RNA)