Show:
A Strange Kind of Beast
Caught Ya!
Be Careful with That
Copy That!
Grab Bag
100
This is what a bacteriophage looks like (draw a picture).
See Board
100
Gel electrophoresis utilizes an electric current to cause fragments of DNA to move down the gel. DNA would move towards this end of the plate (positive or negative) and this is why? **Double Jeopardy Question**
What is the positive end AND because DNA is negatively charged.
100
This is what PCR stands for AND what it is used for.
What is polymerase chain reaction AND it is used to amplify (make more of) a small sample of DNA.
100
This is the name of the process in which bacteria reproduce, but do NOT exchange DNA. **Double Jeopardy**
What is binary fission?
100
This is the technical term for a cell that bursts or ruptures.
What is lysis?
200
This is the name given to viral DNA (or RNA) that has been incorporated into a host's chromosome.
What is a provirus?
200
This is the name of the enzyme that cuts DNA at specific recognition sequences.
What is a restriction enzyme?
200
This is what happens is the electricity is left on too long during gel electrophoresis.
What is all of the fragments will fall off the end?
200
This is the name of the small circular piece of DNA that some bacteria contain.
What is a plasmid?
200
This is the name for a a layer that some bacteria have outside of their cell wall. It is sticky and allows the bacteria to stick to the host and cause infection easier.
What is a capsule?
300
This is a kind of virus that has a special outer covering around the capsid and is particularly difficult for a host to get rid of. **Double Jeopardy Question**
What is an enveloped virus?
300
This is the number of fragments that would result from the enzyme ecoR1 cutting the following DNA sequence at the recognition site:GAATTC CTTAAG DNA Fragment: ATGAGATCTACGGAATTCTCAATTCGAATCC TACTCTAGATGCCTTAAGAGTTAAGCTTAGG
What is 3?
300
Removing a specific gene from an organism is referred to as _______.
What is gene splicing?
300
This is the name of the process in which a viral vector (message carrier) is used to transfer a piece of DNA from one bacterium to another.
What is transduction?
300
Draw a picture of a typical bacteria and label at least six structures.
See board.
400
These are the four stages of viral reproduction in an active virus.
What are attachment on host Cell, insertion of DNA, virus Multiplication, and host cell lysis (out comes many more of those nasty creatures.)
400
This is the difference between a DNA fingerprint and a regular fingerprint.
What is a DNA fingerprint is a pattern of bands on a gel made from fragments of DNA and a regular fingerprint is the pattern of skin ridges on the surface of an individual's skin?
400
This is the term for connecting DNA fragments from different sources. (Ex. Taking a gene for insulin production from a human and inserting it into a bacterial cell)
What is recombinant DNA?
400
A bacterial pilus is used to transfer genetic material between bacteria during this process.
What is conjugation?
400
This is what RFLP (Restriction Fragment Length Polymorphism) are used for.
What is to create a DNA fingerprint? Or, to match crime scene DNA to a suspect? Or, to match a child to biological parents, etc.
500
These are three differences between the lytic and lysogenic cycle AND this is an example of a lytic virus and a lysogenic virus.
Lytic: host cell lysis, short term, viral DNA is not incorporated into host cell's chromosome. Ex. Influenza... Lysogenic: host cell does not lyse, long term, viral DNA is incorporated into host's chromosome. Ex. Herpes, HIV...
500
Looking at the DNA fingerprint on the board, can you conclude that Sam and Ted are biological sons of Sandy and Bob? What else can you tell about Sam and Ted by comparing their DNA banding pattern?
They are both adopted but they are identical twins.
500
This is a definition for genetic engineering AND TWO ways that genetic engineering has been used to benefit society.
What is the manipulation of an organisms genome by adding or removing genes? Lots of answers.
500
This is what protease, integrase, and reverse transcriptase do.
Reverse transcriptase transcribes a single RNA strand into a double RNA/DNA strand; Integrase integrates the viral DNA into the host cell's genome (first creates sticky ends); protease cuts/cleaves large viral proteins into smaller ones.
500
These are FOUR reasons why viruses are not considered living. *They need a host to survive is NOT one of them.
What is they don't grow, utilize energy, don't have cells, or respond to stimuli.