Mitosis
PMAT stands for
prophase, metaphase, anaphase, telophase
How many divisions are in meiosis?
two
What are alleles?
alternative forms of genes
What are the nucleotides?
ATGC
U in transcription
How long have I been an SI for gen bio with Vince?
3 semesters
How many divisions are in mitosis?
one
haploid
What does it mean to be homozygous or heterozygous?
homozygous = same alleles
heterozygous = different alleles
What does topoisomerase do?
relaxes DNA and unwinds the double helix
How old am I?
20
What is the end result of mitosis?
2 identical daughter cells
What is the end result of meiosis?
4 genetically diverse daughter cells
If I cross a blue flower with a pink flower and I get a purple flower, what type of dominance is this demonstrating?
Incomplete dominance
If a DNA Strand reads 5' ATGCGCTTTAAAGACCAGTAG 3' what would it transcribe as?
5' AUGCGCUUUAAAGACCAGUAG 3'
What is my major?
Psychology
What is a centriole?
The anchors for mitotic spindles.
What are two ways that meiosis increases genetic diversity?
Crossing over and random assortment
If I have a brown cow and cross it with a white cow and I get a white and brown speckled cow, what kind of dominance does this demonstrate?
Codominance
Translate this stand: 5' AUGCGCUUUAAAGACCAGUAG 3'
Met Arg Phe Lys Asp Gln STOP
When am I expected to graduate?
December 2023
At what point is the nuclear envelope completely gone . . .
by metaphase
What is one way that meiosis can go wrong?
nondisjunction
Practice a Dihybrid Cross: In cats orange fur is dominant to white fur and short hair is dominant to long hair. If I have a cat who has white fur and long hair and I cross it with a cat who is homozygous for orange fur and heterozygous for short hair, what are the possible genotypes and phenotypes of their offpring? Will any of them be white?
50% OoSs
50% Ooss
50% Orange & Short
50% Orange & Long
No white
What is the difference between point mutations and frameshift mutations?
Point mutations = base substitutions, reading frame is not shifted
Frameshift mutations = insterting or delting a base, reading frame is shifted
What is my puppy's name?
Gnocchi