Molecular Level
1) 5'- T G A T G C C - 3'
2) 3'- C G C T G T A - 5'
//// Identify Starting frame
1) +3
2) -1
Who is the MRCA for your cousin?
What is an MRCA?
Grandparents
the most recent individual (or couple) from whom two or more people are directly descended
A _______ has a greater effect on genetic mapping and occurs more frequently, whereas a ___________ has a more significant impact on altering the specific arrangement of alleles (producing a "cleaner" rearrangement) but is much rarer due to biological interference.
single crossover
double crossover
(CA)ₙ → CACACACACACA
(GATA)ₙ → GATAGATAGATA
These are examples of.....
SSR ( simple sequence repeats)
Is GAWS an association study, Causation study, or both?
Association ONLY
A DNA sequence is being read in Frame +1. If a double Cytosine (C) is inserted at the very beginning of the sequence, what reading frame does the original sequence now shift into?
+3
a hierarchical clustering algorithm used to build rooted phylogenetic trees based on a distance matrix, assuming a constant rate of evolution (molecular clock)
UPGMA logic
Name the type of rearrangement:
1) both dominant (or wild-type) alleles are located on the same chromosome, and both recessive (or mutant) alleles are on the other chromosome
2) each chromosome carries one dominant and one recessive allele
1) Cis
2) trans
different forms of the same enzyme that are encoded by different alleles of the same gene within a species they: ( detected by electrophoresis)
Allozymes
a tool that Scans the entire genome for SNPs associated with a trait, Compares cases vs controls, Identifies statistical associations, not causal mutations
GAWS
If the "top" strand of DNA is
5'- A G C T T A - 3', what is the first codon of Frame -1?
Comp. = 3’-TCGAAT-5’
Rev. = 5’-TAAGCT-3’
Since -1 start coding = TAA
This is lining up DNA (or protein) sequences so that homologous positions are in the same column.
Ex) Species 2: ATGGACTA
Species 1: ??????
Sequence Alignment
ATG-CCTA
Another name for Cis and trans rearrangement is.....
Cis = Coupling
Trans= Repulsion
When two alleles at different loci are inherited together more often than expected by chance
Linkage disequilibrium (LD)
Label each of the following examples properly:
1) AB / AB / ab / ab
2) Ab / Ab / aB / aB
3) AB / ab/ Ab / aB
1) PD
2) NPD
3) TT
A frameshift occurs when nucleotides are inserted or deleted in a number that is not a multiple of 3
Indels
Explain these terms:
Incomplete dominance
Codominance
Lethal alleles
Multiple alleles
1) intermediate blend
2) both alleles are expressed equally
3) Mutation = DEATH
4) Same gene different variant
What is the Recombination frequency equation and what units is it measured in?
ATCGCCTAGCTTTCGAAGTCG
Identify the Minor allele frequency?
A
explain the following, what does it mean?
PD>NPD
PD = NPD
High TT
Genes are linked
Genes are unlinked
Moderate crossover frequency
Label by severity of effect and protein effect :
- SNP Synonymouse
- SNP Missense
- SNP nonsense
- Frameshift
- Neutral / none protein effect
- 1 amino acid charge / varies protein effect L/H
- Protein cut short / high severity
- entire tail of protein is garbage / extreme
Independent assortment (Epstasis) has a ratio of 9:3:3:1.
1- Name all Modified rations and their names
9:7 = Duplicate Recessive Epistasis
9:3:4= Supplementary or Recessive Epistasis
12:3:1= Dominant Epistasis
15:1= Duplicate Gene Action
Grey eye / long legs : 510
Blue eyes / short legs: 210
Grey eye / short legs: 71
Blue eyes / Long legs: 52
Find the Recombination Frequency
14.59% ----> 14.59cM
Name a difference between Enzymes and Allozymes
slightly different amino acid sequences Which can cause small differences in charge, structure, or mobility
Identify the following in a Manhattan plot....
Each dot=?
X-axis=?
Y-axis=?
Higher dot=?
Peaks=?
one SNP
chromosome position
–log10(p-value)
stronger association
genomic regions linked to trait