General stuff
Describe the Central Dogma of Biology
DNA*--Transcription--> RNA --Translation--> Proteins
*Can also be Replicated
Describe primary, secondary, and tertiary structure of DNA
Primary: the covalent structure, the sequence of nucleotides
Secondary: any regular, stable structure by some/all nucleotides in a Nucleic Acid (Double-helix {A-, B-, and Z- forms}, Stem-loop structure)
Tertiary structure: Folding of chromosomes
Using a Western Blot, we can identify __________. (Describe the process)
SDS-PAGE shows the ______ of a sample by sorting components based on ______.
Please also describe size exclusion chromatography, ion-exchange chromatography, affinity chromatography, and salt fractionation
Western Blotting identifies if a protein is present in a sample. In the western blot, an antibody known to bind to the target protein is added to the sample, and other ligands are added to block other active sites. A second antibody (tagged with GFP) is added to bind to the first antibody to visually confirm the presence of the target protein.
SDS-PAGE shows the purity of a sample by sorting components based on size (but also kind of charge but I think charges are kind of equalized but it might be weird if done with a charged molecule)
in size-exchange chromatography, LARGE proteins elute first. In cation-exchange chromatography, the most positive ions elute LAST. In affinity chromatography, components are separated by tags (unwanted proteins elute first). In salt fractionation, proteins are separated by solubility; either the solution or the precipitate can be used for this purification
What are the differences between thermodynamics and kenetics?
1. Binding to the transition state
2. Changing the reaction pathway by creating new intermediates.
Thermodynamics is the relative stability of "before" and "after" the reaction. Kinetics is the rate at which the reaction occurs.
Ligands can _____ (turn on) or _____ (turn off) receptors by binding to them
Describe Desensitization, integration, divergent pathways, and response localization
Describe GPCRs and RTKs
Ligands can AGONIZE (turn on) or ANTAGONIZE (turn off) receptors by binding to them
Desensitization: receptors no longer respond to a continuously present signal; Integration: multiple signals produce a unified response; Divergent pathways: a single signal cases multiple pathways; Response localization: Cells confine a signaling system so the process is only locally regulated.
GPCRs: ligand binds to protein, activating internal G-protein with GTP. G-Protein activates secondary enzyme to produce secondary messenger (amplification). Secondary messenger binds to target protein which causes changes in gene expression/metabolism. Signal is terminated when ligand dissasociates, when something is dephosphorolated, ect.
RTKs: Ligand binding activates the kinase domain, which causes 2 RTK monomers to form a dimer. The subunits phosphorylate each other leading to a kinase cascade and a downstream response
Describe Gibbs free energy (and what the signs mean), Enthalpy, and entropy.
Gibbs free energy is the energy available to do work in a system. If positive, the reaction is exergonic/exothermic, reaction is spontaneous. If negative, the reaction is endergonic, endothermic, and non-spontaneous. If 0, the system is in dynamic equilibrium. (J/mol)
Enthalpy is the Heat Content in the system (J/mol)
Entropy is a measure of disorder in the system (J/mol*K)
(let D = Delta b/c you need to pay to get symbols)
DG = DH - TDS
Please Draw a ribose and deoxyribose sugar. Which bases bind to which?
Can you identify the bases from the slide deck I will now pull up? (If we have to draw it I will MURDER SOMEONE)
Look up pictures!
Deoxyribose = DNA = bases A, G, C, T
Ribose = RNA = A, G, C, U
An oligomer is ________.
The number of amino acid residues can be estimated by _____
Describe primary, secondary, tertiary, and quaternary structure
an oligomer is some number of polypeptide units (monomer, dimer, trimer, tetromer, ect.)
The number of amino acid residues equals about the molecular weight (in daltons)/110
Primary structure is the sequence of amino acids. Secondary structures are backbone folds that minimize torsion stress (a-helixes and B-barrels). Tertiary structure is the overall 3-D structure of a molecule, caused by non-covalent bonds between resides. Quaternary structure us multiple subunits coming together to form one structure
1/20= 1[S]/(25*10-3) + [S]
(25*10-3) + [S] = 20[S]
(25*10-3)=19[S]
(25*10-3)/19=[S]
[S] = 1.32 mM
Sugars from aldehydes are _____ sugars while sugars from ketones are _____ sugars
How are sugars classified as D- or L-
There is a Fischer projection picture that goes with this! Please draw the Hayworth pojection
There is also a hayworth projection associated with this. Draw the Fischer pojection
Sugars from aldehydes are aldose sugars while sugars from ketones are ketose sugars
In a fischer projection, if bottom OH is on the RIGHT, it's a D-sugar (D for the latin Dextrus and L for left)
[See Picture] (it cost money to get the answers, we're just checking with each other and the notes.)
When pKa is _______ than the pH, the molecule is protonated
pH = pKa + log(what goes here??)
when the pKa is LESS THAN the pH, most of the molecules are protonated.
pH = pKa + log([A-]/[HA])
From which end to which end are DNA sequences written in? What if both paired strands are shown?
DNA spirals are ____-handed. The two strands are ____parallel. The 3-D structure relates to the solubility of the components of DNA because _______
A codon contains ___ nucleotides
Nucleic acids are written from the 5' (side with the base on it/exposed phosphate group) to 3' (side with -OH on it) end. W/ two strands shown: top 5'->3', bottom 3'-5'
DNA spirals are right-handed. The two strands are antiparallel. The 3-D structure relates to the solubility of the components of DNA because the highly polar phosphate groups and sugar residues are on the outside of the double helix while the hydrophobic bases are on the interior of the helix.
A codon contains 3 nucleotides
Please list all 20 amino acids, their 1-letter code, and their 3-letter code.
Please identify the amino acids shown in the deck I have on my laptop.
Draw a Glycine. Indicate where a prosthetic group would be added on other amino acids.
ALIPHATIC: Alanine, A, ala; Glycine, G, gly; Isolueucine, I, ile; Leucine, L, leu; Proline, P, pro; Valine, V, val
AROMATIC: Phenylalanine, F, phe; Tryptophan, W, trp; Tyrosine, Y, tyr
ACID: Aspartic Acid, D, asp; Glutamic Acid, E, glu
BASIC: Arginine, R, arg; Histidine, H, his; Lysine, K, lys
HYDROXYLIC: Serine, S, ser; Threonine, T, thr
SULFER: Cysteine, C, cys; Methionine, M, met
AMIDIC: Asparagine, N, asn; Glutamine, Q, gln
Phosphatidylinoaitol is a type of lipid structure with a GLYCEROL backbone (draw this structure) and that has a role in SIGNALING. It can be phosphorolated in the 3, 4, and 5 positions of the glucose molecule it is associated with by the PI-KINASES enzymes and it can be dephosphorolated by PI-PHOSPHORASES enzymes.
Blood type is determined by _______, where types A and B have different _______, AB has ____, and O has ______
Blood type is determined by glycoproteins, where types A and B have different terminal glycoproteins, AB has both, and O has neither.
(From exam 1)
True/False
The strength of a hydrogen bond is dependent on 3D orientation of the hydrogen bond donor and the hydrogen bond acceptor
(Follow-Up)
Hydrogen bonds _______, _____, and ______ are examples of non-covalent interactions
Can you order 3 of these from strongest to weakest.
True! The hydrogen bond is stronger if the molecules in the hydrogen bond are in a straight line.
Hydrogen bonds van der waals interactions, ionic bonds, and hyrdophobic aggregation are examples of non-covalent interactions
Covalent > H-bond > van der waals
Below are the recognition sites of two enzymes
BamHI:
5’ G|GATCC 3’
3’ CCTAG|G 5’
BclI:
5’ T|GATCA 3’
3’ ACTAG|T 5’
DNA:
5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’
3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’
If this DNA was cut with these, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments.
Don't actually have an answer key but here is the answer I got:
*expect 3 fragments, them MIDDLE FRAGMENT is below: - = sticky ends
5' GATCCGTAATGTGTCCT - - - -3'
5' - - - -GCATTACACAGGACTAG 3'
Describe proteostasis and the free-energy funnel.
What are the 3 methods to determine proteins structure and what are the benefits/drawbacks of each?
proteostasis is the continuous maintenance of the active set of cellular proteins. The Free-Energy funnel describes how multiple pathways can lead to one stable outcome. These outcomes can sometimes be TOO stable (and lead to aggregation. When a protein is stuck in a stable "pocket" but needs to change conformation to be more stable, a chaperone can help it to its native conformation.
NMR spectroscopy: detects secondary structure via nuclear spin. Shows native structures in solution. Not great for large molecules
X-ray crystallography: high resolution by measuring the rotation of a crystalline form of a protein. High resolution, can handle larger molecules, doesn't show proteins in native solutions, not all proteins can form crystals
Cryogenic Electron Microscopy: Frozen sample is put in an electron microscope to see 2-D pictures of structures. Can see multiple proteins at once and can handle large complexes, lower resolution than crystallography and lots of data that needs processing.
There are 3 types of reversible enzyme inhibition:
In ____ inhibition, the inhibitor and substrate compete for the same active site. Vmax ____ and Km ____
in _____ inhibition, the inhibitor binds to the ES complex. Vmax ____ and Km ____
in _____ inhibition, the enzyme is changed via allostery. Vmax ____ and Km ____
In COMPETITIVE inhibition, the inhibitor and substrate compete for the same active site. Vmax DOESNT CHANGE and Km -> aKm (In LB plot, the slope changes but the x-intercept doesn't change)
in UNCOMPETITIVE inhibition, the inhibitor binds to the ES complex. Vmax DECREASES and Km -> Km/a' (Slope is the same, the x-intercept changes)
in NON-COMPETITIVE inhibition, the enzyme is changed via allostery. Vmax DECREASES and Km DOES NOT CHANGE
Immune Function!
Describe the innate and adaptive immune response. What are the parts of the adaptive immune response?
Describe the function of the following:
B-lymphocytes, T-lymphocytes, Helper T-cells, memory cells
Describe antibody structure
Innate immune response has No Memory (neutrophils, macrophages, skin, mucus, stomach acid) while the adaptive immune response has memory.
The adaptive immune response functions through the humoral immune system (antibodies) and the cellular immune system (engulf infected cells)
Humoral: B-lymphocytes produce antibodies
Cellular: T-lymphocytes recognize infections via surface receptors, Helper T-cells produce signaling molecules molecules, and memory cells form a rapid response to reacurring pathways
Antibodies have 2 heavy chains and 2 light chains which allow for antigen recognition at the Epitope (a variable domain on the heavy chain). They bind tightly and specifically to antigens
For protein binding:
Y = [L]/ ([L] +Kd)
What do each of these variables mean?
Y is the fraction of protein bound to a ligand at concentration [L].
Kd is the concentration of ligand at which 1/2 of the protein is ligand-bound, the rate of disassociation/the rate of association
*Low Kd = high affinity for ligand
Describe PCR and Cloning
PCR: DNA is extracted, and added to a solution with primers and nucleotides. Heating Denatures the DNA, primers anneal as it cools again, the enzymes extend primers creating additional strands of DNA. (2^n copies)
Cloning
Jokes on you these are lipid questions.
In the lipid membrane, lipids can move between the two bilayers with three enzymes. Describe how these move.
What are the 3 types of membrane proteins?
_____ proteins play a role in endocytosis and ____ play a role in membrane curvature
Hemoglobin and myoglobin?
Flipases catalyze diffusion from the outer to inner membrane.
Floppases catalyze diffusion from the inner to outer membrane.
Scramblases move along the concentration gradient.
Integral, peripheral, and lipid-linked.
SNARE proteins play a role in endocytosis and BAR domains play a role in membrane curvature
Hemoglobin has 4 heme subunits and is in blood to transport O2 from lungs to target tissues. Because of Allosteric effects, the binding of each additional oxygen gets easier (This is Homotrophic allostery because the allosteric ligand and the other ligand are the same).
Myoglobin has one heme subunit and binds to oxygen much tighter than hemoglobin does.
______ are storage lipids with a ____ backbone.
_____ still have a ____ backbone, with 2 fatty acid tails and a phosphate group attached via _____ bonds
_____ Usually only has one fatty acid tail, with a ______ backbone. A phosphate group can also be added to these lipids to change function.
_____ have a 4-ring structure and play a role in cell membrane structure and in cell signaling.
TRIACYLGLYCEROLS are storage lipids with a GLYCEROL backbone.
GLYCEROPHOSPHOLIPIDS still have a GLYCEROL backbone, with 2 fatty acid tails and a phosphate group attached via ESTHER bonds
SPHINGOLIPIDS Usually only has one fatty acid tail, with a SPHINGOSINE backbone. A phosphate group can also be added to these lipids.
STEROLS have a 4-ring structure and play a role in cell membrane structure and in cell signaling.
Describe the protein structure of Microtubules and an actin
Describe a myosin cycle and motor proteins
Microtubules: alpha and beta tubulin subunits, association/disassociation is determined by GTP/GDP on the beta subunit and by MAPS.
Actin: Assembled from "pointed" to "barbed" end, constant length via treadmilling as ATP -> ADP. G-actin subunits
Myosin: ATP binds to myosin head causing dissociation from actin. The ATP is hydrolyzed to ADP+P. Myosin head binds to actin filament, releasing P. This causes the power stroke and the myosin heads move the actin & myosin units relative to each other
Motor proteins: Kinesin (moves anterograde, to barbed (+) end) and Dynein (moves retrograde, to pointed (-) end)