Transcription
What is transcription?
What is the synthesis of mRNA using DNA as a template?
What are the four bases of DNA?
What are adenine, guanine, thymine, cytosine?
What is translation?
What is the synthesis of a protein using mRNA as a template?
What is an operon?
A cluster of genes under the control of a single regulatory element
In the presence of lactose is the lac operon on or off?
What is on?
Which enzyme creates the mRNA from the DNA template strand?
What is RNA polymerase?
What shape is DNA?
Where in the eukaryotic cell does translation take place?
What is the cytoplasm or ribosome?
What binds to the promoter of an operon to start transcription?
What is RNA polymerase
What is the major advantage to regulating genes?
What is conserving resources?
What is the mRNA strand made from the following DNA template?
TACGGATACCCAAATTGAATT
What is AUGCCUAUGGGUUUAACUUAA
What are the four bases in RNA?
What are adenine, guanine, cytosine, uracil?
What is the appropriate amino acid sequence for the following mRNA sequence? AUG CCU AUG GGU UUA ACU UAA
met –pro –met –gly–leu–thr–stop
What is the operon called that consists of genes coding for enzymes that break down lactose?
What is the lac operon?
What binds to the promoter in eukaryotic cells?
transcription factors
Where does transcription take place in a eukaryotic cell?
What is the nucleus?
What is the central dogma?
What is DNA --->RNA--->protein
Translation is so named because we are translating something. What is the “translator”?
What is tRNA?
What is the activator in the lac operon?
Can transcription and translation happen at the same time in prokaryotes?
Can transcription and translation happen at the same time in eukaryotes?
Yes (prokaryotes)
no (eukaryotes)
Draw the basic process of transcription. Label the following three components: DNA, RNA polymerase, mRNA
Answers will vary
What are the three components of a nucleotide?
What are
phosphate
sugar
base
Draw and label a diagram of translation. Include the following: mRNA, codon, anticodon, tRNA, amino acid
answers will vary
What binds to the operator in the lac operon in the absence of lactose?
What is the repressor?
What is rRNA?
What is ribosomal RNA?