Transcription
What is transcription?
What is the synthesis of mRNA using DNA as a template?
What are the four bases of DNA?
What are adenine, guanine, thymine, cytosine?
What is translation?
What is the synthesis of a protein using mRNA as a template?
What are the protein coding regions of mRNA called?
What are exons
Which enzyme creates the mRNA from the DNA template strand?
What is RNA polymerase?
What shape is DNA?
Where in the eukaryotic cell does translation take place?
What is the cytoplasm or ribosome?
What is added to the 5' end of mRNA
5' G cap
What is the mRNA strand made from the following DNA template?
TACGGATACCCAAATTGAATT
What is AUGCCUAUGGGUUUAACUUAA
What are the four bases in RNA?
What are adenine, guanine, cytosine, uracil?
What amino acid does every new protein start with.
met
What is added to the 3' end of mRNA
Poly-A tail
Where does transcription take place in a eukaryotic cell?
What is the nucleus?
What is the central dogma?
What is DNA --->RNA--->protein
Translation is so named because we are translating something. What is the “translator”?
What is tRNA?
What are the components of a mature mRNA strand?
What is the 5' cap, exons, and poly-A tail
What direction is the mRNA stand made on the DNA template.
5' - 3'
What are the three components of a nucleotide?
What are phosphate, sugar, base
What are the 3 sites called in the ribosome?
A (acceptor), P (peptidyl) and E (exit)
What is the name for taking out the introns during mRNA editing.
What is splicing.