Intro
The main pathway this paper discusses.
What is the canonicalWnt/β‐catenin pathway?
The proteins these antibodies bind to and functions of the proteins: anti MAP-2, anti B-catenin, anti-LRP6, anti-GPR37.
MAP 2: neuronal marker, B-cat: intermediate/downstream molecule of Wnt/B-catenin signaling, LRP6: coreceptor of Wnt/B-catenin signaling, GPR37: possible interacting player of Wnt/B-catenin, also expressed in mature and pre-myelinating oligodendrocytes.
The purpose of immunofluorescence
What is show localization of proteins of interest?
The type of regulator they found GPR37 to be. (pos/neg)
The relationship between LRP5/6
What are orthologs?
Functions of ER Chaperones? The ER Chaperone in this context is...
What are molecules in the ER that stabilize and support the folding process of proteins? What is GPR37?
Purpose of the siRNAs in this paper.
What is blocking GPR37 mRNA to create and analyze knockdown models?
The purpose of co‐immunoprecipitation assays and the method they used to detect it.
What is to see whether two proteins directly interact; Western blots?
The relationship between LRP6 and GPR37 (2 answers)
What are:
1. GPR37 is required for LRP6 maturation
2. Protects from ER-associated degradation
The reason folding is important
What are misfolded proteins do not complete and/or alter their functions and are tagged by ubiquitin for proteasomal degradation
The reason LRP5/6 is prone to misfolding.
What are disulfide bridges?
Function of a loading control in Western blots
What is to ensure all wells are loaded equally?
Two tags that were used in co-immunoprecipitation assays.
What are the V5 and FLAG tags?
The other chaperone GPR37 is similar to.
What is Mesd?
The terminus that GPR37 interacts with LRP6
The domains of LRP6 that GPR37 assist in the maturation process
What are the E1 and E2 domains?
The functions and methods involving neurospheres and why they decided to include neurospheres
What are qPCR and immunofluorescence techniques? What are neural stem cells models to examine Wnt-signaling?
The purpose of the FACS analysis and FACS meaning
What is to determine cell-surface LRP6 levels; fluorescence activated cell sorting?
The difference (if any) between calreticulin and calretinin!!!
1. calreticulin is an ER marker
2. calretinin is an immature neuron marker
The differences between Mesd and GPR37 in regards to folding.
What are?
Mesd is involved in all 4 E domains
GPR37 is only involved in the first two E domains.
The 3 repeat sequences in the secondary structure of LRP6.
What are type A repeats, epidermal growth factor repeats (EGF), and YWTD repeats?
The guide RNA (gRNA) used to generate the LRP6-KO/HEK293T cells? How long are primer sequences on avg?
What is ATTATTGTCCCCCGATGGGC? What is 18-30bps?
The purpose of SiT
What is a trans-Golgi marker?
How GPR37 regulates neuronal fate.
Not sure! But they used KO models to show GPR37's involvement in neuronal fate
The tissue lysates from the female mice were given these treatments to obtain single-cell suspension.
What are papain, trypsin, and DNase I?