Transcription
The direction in which the template strand is read during transcription
What is 3' to 5'
What is Rubisco and what does it do?
What is an enzyme in the Calvin cycle that fixes carbon?
Name three structural differences between DNA and RNA
DNA is primarily double stranded, RNA is primarily single stranded.
RNA nucleotides have a 2’ Hydroxyl group (OH) on the ribose sugar , DNA nucleotides have a 2’ H.
DNA has thymine, RNA has uracil.
Which level of protein structure contains only polypeptide bonds?
Primary Structure
Which feature of DNA allows proteins to identify sequences without unwinding it?
Major groove
The sequence of RNA (5' -> 3') produced by gene A, where the arrow represents the direction and length that RNA polymerase will move across the DNA.
Gene A ->
5’ GCCTATAGCCAATCGTACTTAGGC 3’
3’ CGGATATCGGTTAGCATGAATCCG 5’
What is 5’ AUCGUACUU 3’
Where do the “light reactions” happen within the chloroplast?
What are the thylakoids?
What information does the image on the right give you over the image on the left for the circled band?
The Southern blot tells you the size and sequence of a molecule. The DNA gel only tells you the size.
This type of mutation leads to a premature STOP codon
Nonsense Mutation
Name one example of a secondary structure motif in protein
Alpha helices or Beta sheets
Transcription termination in prokaryotes depends on this additional factor, which terminates transcription at this location.
What are Rho and RNA polymerase
The enzyme in the thylakoid membrane that produces ATP using H+ ions
What is ATP synthase?
At 90 degrees celsius, would Yeast DNA be double-stranded or single stranded?
Single stranded.
Use the codon chart to translate this NON-TEMPLATE Strand of DNA:
5’ - TTGCGATGGCCCAGTATGATATTCTATAGGC - 3’
Coding region of the mRNA: AUG-GCC-CAG-UAU-GAU-AUU-CUA-UAG
Met - Ala - Gln - Tyr - Asp - Ile - Leu - Stop
In what environment is fermentation necessary? Why?
Anaerobic environment.
Needs to recycle NADH back to NAD+ to continue producing ATP, otherwise cell would die.
Components of mature mRNA in eukaryotes
What are 5’ cap, 5’ UTR, coding segment, 3’ UTR, poly-A tail?
What two molecules are produced by the “light reactions” for use by the Calvin cycle?
What are ATP and NADPH?
What is the sequence of the probe that will bind RNA from this gene at the given location (red bar)?
5’-CGATTGAC-3’ OR 5’-CGAUUGAC-3’
What would happen to the translated protein if the italicized “T” was changed to an “A”?
5’ - TTGCGATGGCCCAGTATGATATTCTATAGGC - 3’
The STOP codon would be changed to Lys. Translation would continue until it found a random STOP. Longer protein probably won’t function.
When you perform a northern blot analysis, you find multiple bands matching your unique RNA sequence. Why might you get this result?
Alternative Splicing has created multiple mRNA products of different sizes which produces different bands
Determine the sequence of mature mRNA produced by this gene
What are
5’ cap
5’ UTR: AAUUAAUU
exon 1: GACGUAUGUCAAUCGGUAAG
exon 2: ACUGAAUACACGCCAAUAAAUGA
poly A tail: AAA...AAA
Categorize all inputs, outputs, and recycled components of the Calvin cycle
inputs: ATP, NADPH, CO2
outputs: g3p, Pi, ADP, NADP+
recycled components: RuBP
Person B has a disease that is caused by a malfunction in gene X. You probe against an exon for gene X and get the following blots. What is different about gene X in person B relative to healthy person A?
Person B’s gene X RNA is not spliced.
Name each of the labeled structures involved in production and protein trafficking
Nuclear Envelope
Rough Endoplasmic Reticulum
Golgi Apparatus
Vesicle
Cell Membrane
Ribosome
Draw the “Z-Scheme” of the electron transport during photosynthesis
See image